ORFeome > parvg ORF1 – XORFeome v1.0

parvg ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: parvg
Gene ID: 996665
Gene Page ID: 996661
ORF Xenbase ID: 17288109

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC129728
Original XGC clone length: 945

Human orthology & disease relationships

NCBI Entrez ID: 64098
Ensembl gene IDs: ENSG00000138964
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 124900,125800,161800,182290,301000,313900,600652,603278,603622,605249,607841,608751

Library Location

Plate ID: GDExl11092
Well Location: A10

Sequences - 5ʹ (forward) EST

Accession: JZ838930
dbEST ID: 79656632
Trimmed Sequence: ATGGAGTCACTTCTACCATCCGCCGATGCCCAACTCAGCGTCTTCGATAGCTCTGATACTCCAGGAGAAATAAAGAAGTATATACAGTCGAATGCGAAAAATGACCCCAGATTCCTAGAGCTGCAGACGTTCCTGATTGATTGGATTAACACCGAACTGAAAGAGGAGCACATTGTGGTGAAGAGCATTGAGGAGGACCTGTATGATGGGCTCGTTCTTCATCATCTGCTCAAAACAATTGCGGGAATGAAACTGGAAGTGGAGGAAATTGCACTGTCAGCCAACAGCCAGAAGCGCAAGTTGGGAATCATTATGGAGGCCATATCCCAGAGTCTGCAGCTGCAGGAGACTGACCTGAAATGGAGCATAAATGAGATCCACAACAAGGACCTACTGTGCACGTTGCACCTCATTGTGGCCCTCGCTCAGCACTTCCGACCGGACTTGGAGCTTCCGGTCAACGTGGGAGTAGAAGTGATCAGAGTGTAGCCGAACCGAAGTGGAATTAAAACGGAGAACGTTATTGAATATATTACTGGCAGCAGGGACGGAGATGCCAAATCAAAGCCCGAGGCGTTCGATCACCTGTTTGAACAGAATCCCGAAAAAGTGGAGGATGTAAAAAAGGAAATATAAGTTTTGTGAACAAACGCTTGTTAACCGTGAGCCTGACGGGTGAGGAGCTGGGAAAACAATTTGGTTGATGGCGTGATTCTCCGGTCTCCCCAACTGGCCAACAGGAAAGGAATGTTGAGAAAAGCTTATCTCCTTTTTTCTTTATCCCCCCGTCGCCGGGGGGAAACAAGGGGTTCGTAGGGGT
Full Trace Sequence: GGCGGGCCCAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGAGTCACTTCTACCATCCGCCGATGCCCAACTCAGCGTCTTCGATAGCTCTGATACTCCAGGAGAAATAAAGAAGTATATACAGTCGAATGCGAAAAATGACCCCAGATTCCTAGAGCTGCAGACGTTCCTGATTGATTGGATTAACACCGAACTGAAAGAGGAGCACATTGTGGTGAAGAGCATTGAGGAGGACCTGTATGATGGGCTCGTTCTTCATCATCTGCTCAAAACAATTGCGGGAATGAAACTGGAAGTGGAGGAAATTGCACTGTCAGCCAACAGCCAGAAGCGCAAGTTGGGAATCATTATGGAGGCCATATCCCAGAGTCTGCAGCTGCAGGAGACTGACCTGAAATGGAGCATAAATGAGATCCACAACAAGGACCTACTGTGCACGTTGCACCTCATTGTGGCCCTCGCTCAGCACTTCCGACCGGACTTGGAGCTTCCGGTCAACGTGGGAGTAGAAGTGATCAGAGTGTAGCCGAACCGAAGTGGAATTAAAACGGAGAACGTTATTGAATATATTACTGGCAGCAGGGACGGAGATGCCAAATCAAAGCCCGAGGCGTTCGATCACCTGTTTGAACAGAATCCCGAAAAAGTGGAGGATGTAAAAAAGGAAATATAAGTTTTGTGAACAAACGCTTGTTAACCGTGAGCCTGACGGGTGAGGAGCTGGGAAAACAATTTGGTTGATGGCGTGATTCTCCGGTCTCCCCAACTGGCCAACAGGAAAGGAATGTTGAGAAAAGCTTATCTCCTTTTTTCTTTATCCCCCCGTCGCCGGGGGGAAACAAGGGGTTCGTAGGGGT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAGTCACTTCTACCATC

Sequences - 3ʹ (reverse) EST

Accession: JZ838929
dbEST ID: 79656631
Trimmed Sequence: CCTGCGCTTGTGTCTCAGGAACAGTCCGTACAGGAGCCGCAGAGTCGCTTTTAGATCCCCATTCACTATATCTGCAGGGTTAATAGGATTCTCTATGATCCCTCCTTCCAAAAGAAGATCCAGTGCCAGCGAGACGTTATGAACCTTGTCTTCCTGGGTGCCGGGAGTCAGGAAAAAGGAGCTGAGATTCATGAAATAGCCTTCCAGTTGCCCGATGAGGAGCAGGAGGATTACGCCATCAGCAAACTGGCTCTCCAGCTCCGTCACCGTCAGGCTCAGGTTTACCAAGTGTTTGTTCACAAAATTTATGATCGCCTTCTTTACATCTTCCACTTTTTCGGGATTCTGTTCAAACAGGTGATCGAACGCGTCGGGCTTTGATTTGGCATCTCCGTCCCTGCTGCCAGTAATATATTCAATAACGTTCTCCGTTTTAATTCCACTTCGGTTCGGCTCCACTCTGATCACTTCTACTCCCACGTTGACCGGAAGCTCCNAGTCCGGTCGGAAGTGCTGAGCGAGGGCCACAATGAGGTGCAACGTGCACAGTAGGTCCTTGTTGTGGATCTCATTTATGCTCCATTTCAGGTCAGTCTCCTGCAGCTGCAGACTCTGGGAAATGGGCCTCATAATGATTCCCAACTTGCGCCTTCTGGTTGTTGGCTGGACGTTGCAATTTCCTCCCCTTCCATTTTCCATTCCCGCAAATTGGTTTGTAAACAAAATGATGAAAAAACCAAGCCCCCTTCATACCAGTTCCCTCCCT
Full Trace Sequence: GAGACGGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACCTGCGCTTGTGTCTCAGGAACAGTCCGTACAGGAGCCGCAGAGTCGCTTTTAGATCCCCATTCACTATATCTGCAGGGTTAATAGGATTCTCTATGATCCCTCCTTCCAAAAGAAGATCCAGTGCCAGCGAGACGTTATGAACCTTGTCTTCCTGGGTGCCGGGAGTCAGGAAAAAGGAGCTGAGATTCATGAAATAGCCTTCCAGTTGCCCGATGAGGAGCAGGAGGATTACGCCATCAGCAAACTGGCTCTCCAGCTCCGTCACCGTCAGGCTCAGGTTTACCAAGTGTTTGTTCACAAAATTTATGATCGCCTTCTTTACATCTTCCACTTTTTCGGGATTCTGTTCAAACAGGTGATCGAACGCGTCGGGCTTTGATTTGGCATCTCCGTCCCTGCTGCCAGTAATATATTCAATAACGTTCTCCGTTTTAATTCCACTTCGGTTCGGCTCCACTCTGATCACTTCTACTCCCACGTTGACCGGAAGCTCCNAGTCCGGTCGGAAGTGCTGAGCGAGGGCCACAATGAGGTGCAACGTGCACAGTAGGTCCTTGTTGTGGATCTCATTTATGCTCCATTTCAGGTCAGTCTCCTGCAGCTGCAGACTCTGGGAAATGGGCCTCATAATGATTCCCAACTTGCGCCTTCTGGTTGTTGGCTGGACGTTGCAATTTCCTCCCCTTCCATTTTCCATTCCCGCAAATTGGTTTGTAAACAAAATGATGAAAAAACCAAGCCCCCTTCATACCAGTTCCCTCCCT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACCTGCGCTTGTGTCTCAGGAA