ORFeome > pax3 ORF2 – XORFeome v1.0

pax3 ORF2 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: pax3
Gene ID: 6252072
Gene Page ID: 482739
ORF Xenbase ID: 17288145

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC123263
Original XGC clone length: 807

Human orthology & disease relationships

NCBI Entrez ID: 5077
Ensembl gene IDs: ENSG00000135903
Directly associated (OMIM) disease MIM numbers: 122880,148820,193500,268220
Indirectly associated (Lage, et al.) disease MIM numbers: 101000,122880,148820,162091,181450,193500,268220,609637

Library Location

Plate ID: GDExl11091
Well Location: B12

Sequences - 5ʹ (forward) EST

Accession: #N/A
dbEST ID: #N/A
Trimmed Sequence: #N/A
Full Trace Sequence: TCGGGGCCCCAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGACCAGCTTGGCTGGAGCTGTGCCAAGAATGATGAGACCATGCCCAGGACAGAACTATCCCCGGACTGGATTCCCCCCTGGAAGTGTCCACTCCTTTAGGACAAGGCAGGGTGAACCACCTGGGTGGAGTATTTATCAATGGAAGGCCCCTGCCCAACCACATAAGGCACAAAATATTTGAAATGGCACACCATGGCATCCAACCCTGCGTCATCTCGCGCCAGCTCAAATTGTCCCACGGCTGCTTCTCCAAAATCCTGTGTCGCTACCAGGAAACTGGATCCATCAAACCTGGACCCATCGGGGGCAGCAAACCCAAGGTGACTACTCCAAAAGTGGAAAAAAAAATCAAAAAATTTAAAAAAAACAACCCGGGTATGTTCACCTGGGAAATTCGCGATAAATTACTTAAAGACGGATTATGTGATCCCAATACTGTGCCTTCATTAAGCTCCATCACCCGAATTCTGAGGACCAAATTTGGGAAAGGGGATAAGGAGGACATGGAGCTGGATCTAAAGGAGCAAAAAAAAAACCAAAAAAAAACAAACCATACCATTGATGGGATCCTAAGGAAAAAGCTCCACCATCCCCGAATTCTAAGGAAAGGTCTAATATTGACTCCAAACCAAACTGTCTCCGAAAAGGAAGCACCCCAAGAACAAAACCACTTTTCCGGCGAAACAACTGGAAAAAGTTAGAAAAGGCTTCCCAAAAAACCCCTTACCCCGAATTTTATACACCAAAAAAAAATGGCCCCCCAAAAACCAGAATCTCCCAGAAGCCGCGAATTTGCAGGGGAACCCGGGGGGCCCTGTG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGACCAGCTTGGCTGGA

Sequences - 3ʹ (reverse) EST

Accession: #N/A
dbEST ID: #N/A
Trimmed Sequence: #N/A
Full Trace Sequence: GGGAAAAGGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCTTTGCACCAAATTGAAAAGCAAGGCTTTCTTTAAATGCCACCTTTGAACAAAAAAGTTGGCAAGGCCCTCTCTACCTGAGCTCTCTCCTCTGTGAGCTTGGAGCTCTGAGGAATCCTCCCTCTTTGCACAAGCAACCGGGCATTTCGTTCAAAGCCTACCAGAAACTCGACCTTCACGCGAACAACAGAACCAATCCAGTATACACCGCGACAAGCTGCTGCGCCCTCCCGCCGCAACCGCGATCAGATTGCGGTCATGACCTCAGCCATGACAATAATCTCTTCCACCTCCGCTCACAATGATCGACGACGAAATCGTTGAGTCAGGAGGAATCAACATTGTGTTGCGGCCGTATTACGTAGAGTATCAGGGCCCCATAAACCACGGTCAAAGAAGGGCATACCCCCCTAACGCAGATCGGTCCTCTCGCAAGCGGACTATGTACAAGCATCTCCTCGGCGGGCACTAAATATACCCCTAGAATTCCCCTACGGCGTGCAATGGCGGGGGACCGTTTTAAATTTCCACATCATTTTCCTCGCTCAGGGGAAACAAACGTTGGGTGAGAAGCTCACCAGAAGTTTTCGAGGTTCGTATGGCACCAGCACCACGCGGATCTCCCGTGGGATTCAGGTGACATTTCTGCATTTTGAATCCAGGGCAGGCGGCGGCAGACCTACCGAGGCGGCAGGCGAGAGGGGGTGAAGGCATCTTCAAGGAAATATATCCCGGAGAAAGAGTTTGGAGCAGAATTTCGTGAATATAATAAGACCACACTCGCCCACGTAGAAAGGGGTTACAAACCTCTGGGGGGGGCTGAGAATGNCGGGAGGAGAGGC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGGCCCTCGCTACCTGAA