ORFeome > pbx1 ORF1 – XORFeome v1.0

pbx1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: pbx1
Gene ID: 1217596
Gene Page ID: 1217591
ORF Xenbase ID: 17288181

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC106422
Original XGC clone length: 1044

Human orthology & disease relationships

NCBI Entrez ID: 5087
Ensembl gene IDs: ENSG00000185630
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 106210,120200,120430,129750,136520,148190,165550,604229

Library Location

Plate ID: GDExl11087
Well Location: C03

Sequences - 5ʹ (forward) EST

Accession: JZ838004
dbEST ID: 79655706
Trimmed Sequence: ATGGACGATCAGCCCAGGTTGATGCACAGCCACCCCGGGGTGGGGATGGCAGGACACCCCAGTCTGTCCCAGCACATGCAGGATGGAACAGGGGCCAACGAAGGGGATGTGGGCAGAAAGCAGGACATTGGGGATATATTACAGCAGATCATGACCATCACTGACCAGAGTCTGGACGAGGCACAGGCCAGAAAACACGCCTTGAATTGCCACAGAATGAAGCCTGCTCTATTCAATGTCTTATGTGAAATTAAAGAGAAGACAGTTCTCAGTATTCGGGGAGCACAAGAAGAGGAACCATCAGACCCCCAGCTGATGCGATTAGATAACATGCTGCTGGCAGAGGGCGTTGCAGGCCCAGAAAAGGGAGGAGGGTCAGCGGCGGCTGCAGCCGCAGCAGCAGCATCAGGTGGAGCTGGAGCCGACAACTCAACTGAACATTCAGACTACAGAGCAAAGCTATCCCAAATAAGACAAATCTATCACACAGAGCTGGAGAAATATGAACAGGCTTGCAATGAGTTCACCACTCACGTAATGAATCTTCTCAGACAGCATAGCAGAACCCGACCCATTTCCCCGAAAGAGATTGAACGTATGGTGTCGATTATCCACAGGAAATTTAACTCTATACAAATGCAACTGAAAACGAACACATGGTGAAGCTGTCATGATCCTGCGCTCCCCGCTTCTTGGATGCGCGGGGAAAAAAGAAAAAAATTTCAACAATCCAACAACAAAAAATTTTGAAAGAGAAGTTCTATTCCAACCCCCACCCAACCCCTAACCCCCAACCAAAAAAGCCCCAAAAAGGGAAATAAGCCA
Full Trace Sequence: CGCGGCCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGACGATCAGCCCAGGTTGATGCACAGCCACCCCGGGGTGGGGATGGCAGGACACCCCAGTCTGTCCCAGCACATGCAGGATGGAACAGGGGCCAACGAAGGGGATGTGGGCAGAAAGCAGGACATTGGGGATATATTACAGCAGATCATGACCATCACTGACCAGAGTCTGGACGAGGCACAGGCCAGAAAACACGCCTTGAATTGCCACAGAATGAAGCCTGCTCTATTCAATGTCTTATGTGAAATTAAAGAGAAGACAGTTCTCAGTATTCGGGGAGCACAAGAAGAGGAACCATCAGACCCCCAGCTGATGCGATTAGATAACATGCTGCTGGCAGAGGGCGTTGCAGGCCCAGAAAAGGGAGGAGGGTCAGCGGCGGCTGCAGCCGCAGCAGCAGCATCAGGTGGAGCTGGAGCCGACAACTCAACTGAACATTCAGACTACAGAGCAAAGCTATCCCAAATAAGACAAATCTATCACACAGAGCTGGAGAAATATGAACAGGCTTGCAATGAGTTCACCACTCACGTAATGAATCTTCTCAGACAGCATAGCAGAACCCGACCCATTTCCCCGAAAGAGATTGAACGTATGGTGTCGATTATCCACAGGAAATTTAACTCTATACAAATGCAACTGAAAACGAACACATGGTGAAGCTGTCATGATCCTGCGCTCCCCGCTTCTTGGATGCGCGGGGAAAAAAGAAAAAAATTTCAACAATCCAACAACAAAAAATTTTGAAAGAGAAGTTCTATTCCAACCCCCACCCAACCCCTAACCCCCAACCAAAAAAGCCCCAAAAAGGGAAATAAGCCA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGACGATCAGCCCAGGTT

Sequences - 3ʹ (reverse) EST

Accession: JZ838003
dbEST ID: 79655705
Trimmed Sequence: CTGTATCCGCCTGTCTGACTGATAACATGGCGAAGGGTATCCACCAGCAGAACTGGGAGTTGAGGGCGAATTGGCTTGACTTCCGTGAACGGACACATTGGTAGCATTCACGGCTGTTTTCGCAGCATAAATATTGGCTTCCTCTTGAAATTTACCTATGTTCTTCTTATAGCGGATTCGCTTATTTCCAAACCAGTTTGATACCTGTGACACTGTGATGGCGCACTTCTTGGCTAGTTCCTCTTTGGCCTCCTCGCTAGGGTATGGGTTGCTGAGGTGGGAATAGAAATACTCGTTCAAAATTTCTGTTGCTTGCTTGTTGAAATTTCTTCTTTTTCGCCGTGCATCCAACAAGCGGGAGCGCAGGATCATGACAGCTTCACATGTGCTCTGTTTCAGTTGCATTTGTATAGAGCTAAATTTCCTGTGGATAATTAACACCATACGTTCAATCTCTTTCGGGGAAATGGGTCGGGTTCGGCTCTGCTCCCCTGACAAATTCATTACCTGAGTGGTGGACGCATTACAACCCGGCTCAGATTTCTCCCTCTCTCTGTTAATAAATTTGTCCTAAATTGGAAAAACATGGGCTCTGTGTCTGAATGTCAAGTTGGAGTGTGGGGGGCGGGGGCGCCTTTATGCTTGGTGGGGGGGGTGGGGGGGGCGCCTAACCTCCCTCCCTTTTCCTTTCCTTGCAAGGCCGGCGCGCCGGCACCCATCTCACCTAAATCGAATCACCCTCTCGGNATTCGGGAGGGGGCCGAGGGTTGGAG
Full Trace Sequence: AAAACGGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACTGTATCCGCCTGTCTGACTGATAACATGGCGAAGGGTATCCACCAGCAGAACTGGGAGTTGAGGGCGAATTGGCTTGACTTCCGTGAACGGACACATTGGTAGCATTCACGGCTGTTTTCGCAGCATAAATATTGGCTTCCTCTTGAAATTTACCTATGTTCTTCTTATAGCGGATTCGCTTATTTCCAAACCAGTTTGATACCTGTGACACTGTGATGGCGCACTTCTTGGCTAGTTCCTCTTTGGCCTCCTCGCTAGGGTATGGGTTGCTGAGGTGGGAATAGAAATACTCGTTCAAAATTTCTGTTGCTTGCTTGTTGAAATTTCTTCTTTTTCGCCGTGCATCCAACAAGCGGGAGCGCAGGATCATGACAGCTTCACATGTGCTCTGTTTCAGTTGCATTTGTATAGAGCTAAATTTCCTGTGGATAATTAACACCATACGTTCAATCTCTTTCGGGGAAATGGGTCGGGTTCGGCTCTGCTCCCCTGACAAATTCATTACCTGAGTGGTGGACGCATTACAACCCGGCTCAGATTTCTCCCTCTCTCTGTTAATAAATTTGTCCTAAATTGGAAAAACATGGGCTCTGTGTCTGAATGTCAAGTTGGAGTGTGGGGGGCGGGGGCGCCTTTATGCTTGGTGGGGGGGGTGGGGGGGGCGCCTAACCTCCCTCCCTTTTCCTTTCCTTGCAAGGCCGGCGCGCCGGCACCCATCTCACCTAAATCGAATCACCCTCTCGGNATTCGGGAGGGGGCCGAGGGTTGGAG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACTGTATCCGCCTGTCTGACT