ORFeome > pcbp3 ORF1 – XORFeome v1.0

pcbp3 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: pcbp3
Gene ID: 944671
Gene Page ID: 944664
ORF Xenbase ID: 17288217

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC041241
Original XGC clone length: 1062

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11009
Well Location: F02

Sequences - 5ʹ (forward) EST

Accession: JZ823655
dbEST ID: 79641357
Trimmed Sequence: ATGGACACCGGTGTGATTGAAGGAGGCCTGAATGTTACACTCACCATCAGATTGCTTATGCATGGGAAGGAAGTTGGAAGCATTATTGGGAAGAAAGGAGAATCTGTTAAAAAGATGCGTGAAGAGAGTGGTGCCCGGATTAACATCTCAGAAGGCAATTGTCCAGAAAGGATAATTACCTTGGCGGGTCCTACGAACGCCATCTTTAAAGCCTTCTCTATGATCATAGATAAACTGGAAGAGGATATCAGCAGCTCCATGACCAACAGCACTGCATCTAGCAAGCCTCCAGTTACCTTGCGTCTGGTGGTTCCAGCCAGTCAATGTGGATCCCTCATTGGCAAGGGAGGTTGCAAAATAAAGGAAATTAGAGAGAGTACAGGGGCTCAGGTACAAGTGGCTGGGGACATGCTGCCTAATTCTACAGAAAGAGCAATCACCATTGCTGGCATTCCGCAATCCATTATAGAGTGCGTCAAACAGATCTGCGTAGTCATGCTGGAGTCACCCCCAAAAGGTGTCACCATCCCATACCGGCCTAAACCCTCCAGTTCACCTGTAATCTTCGCAGGTGGTCAGGTGTCGCGCCAAGCCGGAGGGCACGCATGTGAGACTGACCTGTGGGAGGGGGCGAAGGTCCCACACAGGNNGGGTCTCCCTAGATGCTGTGGATCTCCATGGGGCTTATACCATTTCAGGACAGTATGCCCATCCNTCAGCTGATCTGACCCAGTTGGCACCACTAGCAATGCAGCAGTCCCACTTTCCTTATTGTCCCAAAATGGCACCACCTGGAATTCCATGGGGGGGGGAAATTAAGGCCTTCCCCTCCC
Full Trace Sequence: CAGTATTGATTTTATTTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGACACCGGTGTGATTGAAGGAGGCCTGAATGTTACACTCACCATCAGATTGCTTATGCATGGGAAGGAAGTTGGAAGCATTATTGGGAAGAAAGGAGAATCTGTTAAAAAGATGCGTGAAGAGAGTGGTGCCCGGATTAACATCTCAGAAGGCAATTGTCCAGAAAGGATAATTACCTTGGCGGGTCCTACGAACGCCATCTTTAAAGCCTTCTCTATGATCATAGATAAACTGGAAGAGGATATCAGCAGCTCCATGACCAACAGCACTGCATCTAGCAAGCCTCCAGTTACCTTGCGTCTGGTGGTTCCAGCCAGTCAATGTGGATCCCTCATTGGCAAGGGAGGTTGCAAAATAAAGGAAATTAGAGAGAGTACAGGGGCTCAGGTACAAGTGGCTGGGGACATGCTGCCTAATTCTACAGAAAGAGCAATCACCATTGCTGGCATTCCGCAATCCATTATAGAGTGCGTCAAACAGATCTGCGTAGTCATGCTGGAGTCACCCCCAAAAGGTGTCACCATCCCATACCGGCCTAAACCCTCCAGTTCACCTGTAATCTTCGCAGGTGGTCAGGTGTCGCGCCAAGCCGGAGGGCACGCATGTGAGACTGACCTGTGGGAGGGGGCGAAGGTCCCACACAGGNNGGGTCTCCCTAGATGCTGTGGATCTCCATGGGGCTTATACCATTTCAGGACAGTATGCCCATCCNTCAGCTGATCTGACCCAGTTGGCACCACTAGCAATGCAGCAGTCCCACTTTCCTTATTGTCCCAAAATGGCACCACCTGGAATTCCATGGGGGGGGGAAATTAAGGCCTTCCCCTCCC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGACACCGGTGTGATT

Sequences - 3ʹ (reverse) EST

Accession: JZ828962
dbEST ID: 79646664
Trimmed Sequence: ACTGCTTCCCATGCCACCAGCTTCAGAGGAAAGCCTGACATTAATAAGGTACTGGGCCAAACTAATGCTGGCTGTGGATCCAGTGATGGTCACCTGGCGATCATTTGAGCCCTCCACAGGGTTAGCTATTTTTATCTGAGCCCCAGACATCTGGCGAATTTCATTTATTTTAGCTCCCTGCCGTCCAATGATACAACCGATGAGATCATTTGGAATGGTGAGTTCATGGGAAGTCGCCTGAGCTGAAGCATCAATCCCACCACTGAATCCAGTGTTGCCACTATGGGACATAGGAAAGTGGGACTGCTGCATTGCTAGTTGGTGCAACTTGGTCAGATCAGGCTGAGGAATGGCATACTGTCCTTGAATGGTATAAGCCCCATGGAGATCCACAGCATCTAGGGAGACCCCCCCTGTGTGGGACCTTCGCCCCTCCCACAGGTCAGTCTCACATGCGTGCCCTCCGGCTTGGCGCGACACCTGACCACCTGCGAAGATTACAGGTGAACTGGAGGGTTTAGGCCGGTATGGGATGGTGACACCTTTTGGGGGTGACTCCAGCATGACTACGCAGATCTGTTTGACGCACTCTATAATGGATTGCGGAATGCCAGCAATGGTGATTGCTCTTTCTGTAGAATTAGGCAGCATGTCCCCAGGCACTTTGTACCTGAGCCCCTGTACTCTCTCTAATTTCCCTTTAATTTTGCAACCTTCCCCTGCCCATGAAGGGGATCCACCTTTGAACGGGGGCTGGAAACCCCC
Full Trace Sequence: GGACGGGTATCAGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAACTGCTTCCCATGCCACCAGCTTCAGAGGAAAGCCTGACATTAATAAGGTACTGGGCCAAACTAATGCTGGCTGTGGATCCAGTGATGGTCACCTGGCGATCATTTGAGCCCTCCACAGGGTTAGCTATTTTTATCTGAGCCCCAGACATCTGGCGAATTTCATTTATTTTAGCTCCCTGCCGTCCAATGATACAACCGATGAGATCATTTGGAATGGTGAGTTCATGGGAAGTCGCCTGAGCTGAAGCATCAATCCCACCACTGAATCCAGTGTTGCCACTATGGGACATAGGAAAGTGGGACTGCTGCATTGCTAGTTGGTGCAACTTGGTCAGATCAGGCTGAGGAATGGCATACTGTCCTTGAATGGTATAAGCCCCATGGAGATCCACAGCATCTAGGGAGACCCCCCCTGTGTGGGACCTTCGCCCCTCCCACAGGTCAGTCTCACATGCGTGCCCTCCGGCTTGGCGCGACACCTGACCACCTGCGAAGATTACAGGTGAACTGGAGGGTTTAGGCCGGTATGGGATGGTGACACCTTTTGGGGGTGACTCCAGCATGACTACGCAGATCTGTTTGACGCACTCTATAATGGATTGCGGAATGCCAGCAATGGTGATTGCTCTTTCTGTAGAATTAGGCAGCATGTCCCCAGGCACTTTGTACCTGAGCCCCTGTACTCTCTCTAATTTCCCTTTAATTTTGCAACCTTCCCCTGCCCATGAAGGGGATCCACCTTTGAACGGGGGCTGGAAACCCCC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAACTGCTTCCCATGCCACCAGCTT