ORFeome > pcnp ORF1 – XORFeome v1.0

pcnp ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: pcnp
Gene ID: 12563959
Gene Page ID: 1004652
ORF Xenbase ID: 17288331

ORF full-length analysis tests

Full-Length confidence: unknown
Original XGC clone accession: BC110945
Original XGC clone length: 549

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11085
Well Location: B08

Sequences - 5ʹ (forward) EST

Accession: JZ837740
dbEST ID: 79655442
Trimmed Sequence: ATGCTAAGGACTGAAGGGAAGTGGTTACGTCACGTTTGTGCAGTAGCGTCGGGGAAGATGGCGGATAAGAAGGGGCGATTAGGAGGAGGACCAGAAGAAGATGCAGAAAAAGCAGTGAACACTAAGACTGTTTCTTCCAGCAATGGAGGAGAGAACTCAAGCCGCAGCACTGAGAAAAGGGCAGCTGAGGACTCAAAGAATGAGCCTTGTCCATCTAAGGTTCCGAAAATTGGGTTTGCAATAGGAAGTCAGAGACTGAAGAAATCACAACCCATATCAATCAAACTTGGAGCCAGTAAACCTAAAGAGGCAGCACCAGCCATTGTTAAAAAAAAGAGTGCAGTGGCATCCGTATTTAATGATGATGACGATAGTGAGCCTGAAGAAATGCCCCCAAAGGCAAAAATGCGAATGAAAAATATTGGAAGGGATACCCCTACATCTGCAGGGCCCAACTCATTCAACAAAGGAAAGCATGGATTTTCAGACAGTCCAAAACTGTGGGAGCGGGATATGAAAACTCGGCTGGATCACAAAACTGATGAATT
Full Trace Sequence: TCGGGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCTAAGGACTGAAGGGAAGTGGTTACGTCACGTTTGTGCAGTAGCGTCGGGGAAGATGGCGGATAAGAAGGGGCGATTAGGAGGAGGACCAGAAGAAGATGCAGAAAAAGCAGTGAACACTAAGACTGTTTCTTCCAGCAATGGAGGAGAGAACTCAAGCCGCAGCACTGAGAAAAGGGCAGCTGAGGACTCAAAGAATGAGCCTTGTCCATCTAAGGTTCCGAAAATTGGGTTTGCAATAGGAAGTCAGAGACTGAAGAAATCACAACCCATATCAATCAAACTTGGAGCCAGTAAACCTAAAGAGGCAGCACCAGCCATTGTTAAAAAAAAGAGTGCAGTGGCATCCGTATTTAATGATGATGACGATAGTGAGCCTGAAGAAATGCCCCCAAAGGCAAAAATGCGAATGAAAAATATTGGAAGGGATACCCCTACATCTGCAGGGCCCAACTCATTCAACAAAGGAAAGCATGGATTTTCAGACAGTCCAAAACTGTGGGAGCGGGATATGAAAACTCGGCTGGATCACAAAACTGATGAATTGCCAACTTTCTTGTACCAAGTTGGCATTAAAGAAAACATTGCTTATCAGTTTGTTTGCACGAAACGGTCACTATCACTTCAAAATAAAATACATATTTCCCTTCCAACTGAAATCCCCTAATAGTGAGTCGTATTACCTGGGTAAAAAAAAAATTGCTAGAAAAACAATGAGCCGGTTGTCCCAACACTCAGAAAAGGGAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCTAAGGACTGAAGGGA

Sequences - 3ʹ (reverse) EST

Accession: JZ837739
dbEST ID: 79655441
Trimmed Sequence: TTCATCAGTTTTGTGATCCAGCCGAGTTTTCATATCCCGCTCCCACAGTTTTTGACTGTCTGAAAATCCATGCTTTCCTTTGTTGAATGAGTTTGGCCCTGCAGATGTAGGTGTATCCCTTCCAATATTTTTCATTCGCATTTTTGCCTCTGGGGGCATTTCTTCAGGCTCACTATCGTCATCATCATTAAATACGGATGCCACTGCACTCTTTTTTTTAACAATGGCTGGTGCTGCCTCTTTAGGTTTACTGGCTCCAAGTTTGATTGATATGGGTTGTGATTTCTTCAGTCTCTGACTTCCTATTGCAAACCCAATTTTCGGAACCTTAGATGGACAAGGCTCATTCTTTGAGTCCTCAGCTGCCCTTTTCTCAGTGCTGCGGCTTGAGTTCTCTCCTCCATTGCTGGAAGAAACAGTCTTAGTGTTCACTGCTTTTTCTGCATCTTCTTCTGGTCGTCCTCCTAATCGCCCCTTCTTATCCGCCATCTTCCGGGACGCGACGGCACGAACGTGACGTAGCCACTTCCCTTCGGTCCGTATCATGGGGCCCACTTTGTTTGTACGAGGTTGGGAGGACACAAAAGCAGGGCTCCGCAATTTGTTGCAACGAAGGGGGGACTAGCAGGCGGAAGGGGAAAAAAAAAAAAAAAAAAAAAAAAAAAATATGGACGTGGTATAAAAAGAAGGGGACGGGGAGGAGGGCCGGAATCGCGGGGCGCCGGGGGGGGGGGGGGGCCGTCGCGTGGGAGGGGGAGGAGGGGGGAAACGCCGGGGGGAAAAGAAAGAACAAAAGAAAGGGAAGAAAAAAAGAAAAAGAACGGCGGGGAGGGGGAGAGAAAAAGGGGAGAAAAGAGGAGGGGGAGGGGGGAGGAGAGACGGGGGGGGGAGAAGAGGAAGGAGGAGAGGGAGGGAGGGGGAAAGAGGAGGGGGGGGGAGGGGAGAGNGAGAGAGGAGGAGAGGAAAGAAAGGAGGGAGAGGGGAGGAGGGGGAGGGGAGAGGGNNAGGAGGAGGAAGGAGAGGGAGGGGGGAGGAAGGGGAAAGGAAGAGGAGAAGGGGGNGGAGGGGGGAAGGAGGAGGAGGGGGGGGGGNGGGAGAGAAGAAGAAGGGGGAGGGGGAGAAGGAGGGGGGGAGAGGGGGAGGAAGGGAGGGAGGAGNGGANGGGGGGGGGGGGGGGAGGNGG
Full Trace Sequence: GGGCAGGGAACAGCCACCGAAGAAGGACAAACGAAGACACACAAAGGGGAGAACAGCCAGGAGGGCAAAAACGAGTATATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTCATCAGTTTTGTGATCCAGCCGAGTTTTCATATCCCGCTCCCACAGTTTTTGACTGTCTGAAAATCCATGCTTTCCTTTGTTGAATGAGTTTGGCCCTGCAGATGTAGGTGTATCCCTTCCAATATTTTTCATTCGCATTTTTGCCTCTGGGGGCATTTCTTCAGGCTCACTATCGTCATCATCATTAAATACGGATGCCACTGCACTCTTTTTTTTAACAATGGCTGGTGCTGCCTCTTTAGGTTTACTGGCTCCAAGTTTGATTGATATGGGTTGTGATTTCTTCAGTCTCTGACTTCCTATTGCAAACCCAATTTTCGGAACCTTAGATGGACAAGGCTCATTCTTTGAGTCCTCAGCTGCCCTTTTCTCAGTGCTGCGGCTTGAGTTCTCTCCTCCATTGCTGGAAGAAACAGTCTTAGTGTTCACTGCTTTTTCTGCATCTTCTTCTGGTCGTCCTCCTAATCGCCCCTTCTTATCCGCCATCTTCCGGGACGCGACGGCACGAACGTGACGTAGCCACTTCCCTTCGGTCCGTATCATGGGGCCCACTTTGTTTGTACGAGGTTGGGAGGACACAAAAGCAGGGCTCCGCAATTTGTTGCAACGAAGGGGGGACTAGCAGGCGGAAGGGGAAAAAAAAAAAAAAAAAAAAAAAAAAAATATGGACGTGGTATAAAAAGAAGGGGACGGGGAGGAGGGCCGGAATCGCGGGGCGCCGGGGGGGGGGGGGGGCCGTCGCGTGGGAGGGGGAGGAGGGGGGAAACGCCGGGGGGAAAAGAAAGAACAAAAGAAAGGGAAGAAAAAAAGAAAAAGAACGGCGGGGAGGGGGAGAGAAAAAGGGGAGAAAAGAGGAGGGGGAGGGGGGAGGAGAGACGGGGGGGGGAGAAGAGGAAGGAGGAGAGGGAGGGAGGGGGAAAGAGGAGGGGGGGGGAGGGGAGAGNGAGAGAGGAGGAGAGGAAAGAAAGGAGGGAGAGGGGAGGAGGGGGAGGGGAGAGGGNNAGGAGGAGGAAGGAGAGGGAGGGGGGAGGAAGGGGAAAGGAAGAGGAGAAGGGGGNGGAGGGGGGAAGGAGGAGGAGGGGGGGGGGNGGGAGAGAAGAAGAAGGGGGAGGGGGAGAAGGAGGGGGGGAGAGGGGGAGGAAGGGAGGGAGGAGNGGANGGGGGGGGGGGGGGGAGGNGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTCATCAGTTTTGTGATCCAGCC