ORFeome > pcolce2 ORF1 – XORFeome v1.0

pcolce2 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: pcolce2
Gene ID: 1015984
Gene Page ID: 1015977
ORF Xenbase ID: 17288355

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC054276
Original XGC clone length: 1239

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11002
Well Location: H11

Sequences - 5ʹ (forward) EST

Accession: JZ839335
dbEST ID: 79657037
Trimmed Sequence: ATGAGCTGTTTCCTGGGCTCCCTCCTACTGTTGCTGCTACTGCCATATGGCATCTCAGGGCAACCCAATGAGAGGCAGACTTTCACATGCGGGGGAAATCTGACTGGTGATACTGGGGTGCTAGGAAGTGAGGGATTCCCTGGAGTTTACCCTCCTAACAGCAAATGTACGTGGAAAATCACGGTACCAGAGGGCAAGGTGGTTGTCCTGTCATTTCGCTTCATTGACTTGGAGAGTGACAACTTGTGCCGTTACGACTTTGTGGATGTATATAATGGCCATTCCAATGTGCATCGCATTGGCCGCTTCTGTGGCACCTTTAGGCCTGGCGCTCTTGTATCAAACAGCAACAAGATGTTGGTCCAAATGATTTCAGATGCCAACACCGCTGGAAATGGTTTCATTGCTGTGTTTTCTGCTGCAGAACCCAATGAGAGAGAAGATCAATACTGTGGGGGACGACTGGATAAACCTTCAGGATCCTTCCAAACTCCCAACTGGCCAGAAAGGGATTACCCTGCAAGAGTCACCTGCTCATGGCACATTGTTGCCCCCAAACATCAGGTCATAGAAATGAAGTTTGAAAAGTTTGATGTTAAGAGAGACAATTATTGCCAATATGATTACCTTGCCGGTGTTCCATGGGCGGAAAAATCAATGATGCCAAAAAGAATCCGGGAAAATTCTTGTGGGGGATATTCCACCCAGCCGCCCATTTGTTTTCAAAACAAAATAGAAACTCCTCAACCCATTTCCTTTGTCCGAATTTCAATTTTAAACTTGCTGTAATGGGCTTTTTAAAGGGGCAACTTTAAAA
Full Trace Sequence: CGAGGGCCCAATAATGGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAGCTGTTTCCTGGGCTCCCTCCTACTGTTGCTGCTACTGCCATATGGCATCTCAGGGCAACCCAATGAGAGGCAGACTTTCACATGCGGGGGAAATCTGACTGGTGATACTGGGGTGCTAGGAAGTGAGGGATTCCCTGGAGTTTACCCTCCTAACAGCAAATGTACGTGGAAAATCACGGTACCAGAGGGCAAGGTGGTTGTCCTGTCATTTCGCTTCATTGACTTGGAGAGTGACAACTTGTGCCGTTACGACTTTGTGGATGTATATAATGGCCATTCCAATGTGCATCGCATTGGCCGCTTCTGTGGCACCTTTAGGCCTGGCGCTCTTGTATCAAACAGCAACAAGATGTTGGTCCAAATGATTTCAGATGCCAACACCGCTGGAAATGGTTTCATTGCTGTGTTTTCTGCTGCAGAACCCAATGAGAGAGAAGATCAATACTGTGGGGGACGACTGGATAAACCTTCAGGATCCTTCCAAACTCCCAACTGGCCAGAAAGGGATTACCCTGCAAGAGTCACCTGCTCATGGCACATTGTTGCCCCCAAACATCAGGTCATAGAAATGAAGTTTGAAAAGTTTGATGTTAAGAGAGACAATTATTGCCAATATGATTACCTTGCCGGTGTTCCATGGGCGGAAAAATCAATGATGCCAAAAAGAATCCGGGAAAATTCTTGTGGGGGATATTCCACCCAGCCGCCCATTTGTTTTCAAAACAAAATAGAAACTCCTCAACCCATTTCCTTTGTCCGAATTTCAATTTTAAACTTGCTGTAATGGGCTTTTTAAAGGGGCAACTTTAAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAGCTGTTTCCTGGGCTCCCT

Sequences - 3ʹ (reverse) EST

Accession: JZ839334
dbEST ID: 79657036
Trimmed Sequence: ACATCTCTTGTTTTTTAATGTGTTCAGCAACTTCTGATTCTTGGTTTTGAAAGTCATCACGTAATTGCTGGGTAAAACCTTTGCCCGTCCATCCTCATCCACTTGACCCATGATGATGTAATTCAATCCTCTTCTGACCATTGGGCACTGCTTACAAACCACAGTGATTTTGGCACTCATATTTTTGCCTGCCTGCTGGATTGCCAGCGTACCTTCCTTGTATACACTTATAATGGAAATGGTTGCATACACGCTGCCGCCTCTGCTCACAGTTGTGATAATTGTACCCGTTATAACAAAATTACTGGAACAGTAATTGCTCTCCAGCGTCCCCGTCCGTTTGCATTTCTGTTGGCAAAGTGCAAGGGTTGTTTTCAGACTTGATGTTGTGGTGGCAGGGGTGGTGACAGGAGAAACTGTGGTTGTGGGTAACTTTTTAGGCCTGAATCTGTAATGGCCTTTAAAGCCATCAGCAGTTAAACTGAGATCAGACAAGAACTGGATGAGGAGTTCATTTCGCTCTGAAACAATGGGCGCTGGTGGACTATCCCCACAGAACTTCCCGATTCTTTTCGCATCATTGATTTCTCCGCCATTGAACACCGCCACGTAATCATATCGGCAATAAATGTCTCTCTCTACATCAAACTTTTCAAACTTCAATTCTATTAACCTGAATGTTTGGGGGCCAACATGTGCCCATGAGCAAGTTGACTCCTG
Full Trace Sequence: GCGTGTAACAGCTATGACCATGTAATACGACTCACTATANGGGGATATCAGNCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAACATCTCTTGTTTTTTAATGTGTTCAGCAACTTCTGATTCTTGGTTTTGAAAGTCATCACGTAATTGCTGGGTAAAACCTTTGCCCGTCCATCCTCATCCACTTGACCCATGATGATGTAATTCAATCCTCTTCTGACCATTGGGCACTGCTTACAAACCACAGTGATTTTGGCACTCATATTTTTGCCTGCCTGCTGGATTGCCAGCGTACCTTCCTTGTATACACTTATAATGGAAATGGTTGCATACACGCTGCCGCCTCTGCTCACAGTTGTGATAATTGTACCCGTTATAACAAAATTACTGGAACAGTAATTGCTCTCCAGCGTCCCCGTCCGTTTGCATTTCTGTTGGCAAAGTGCAAGGGTTGTTTTCAGACTTGATGTTGTGGTGGCAGGGGTGGTGACAGGAGAAACTGTGGTTGTGGGTAACTTTTTAGGCCTGAATCTGTAATGGCCTTTAAAGCCATCAGCAGTTAAACTGAGATCAGACAAGAACTGGATGAGGAGTTCATTTCGCTCTGAAACAATGGGCGCTGGTGGACTATCCCCACAGAACTTCCCGATTCTTTTCGCATCATTGATTTCTCCGCCATTGAACACCGCCACGTAATCATATCGGCAATAAATGTCTCTCTCTACATCAAACTTTTCAAACTTCAATTCTATTAACCTGAATGTTTGGGGGCCAACATGTGCCCATGAGCAAGTTGACTCCTG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAACATCTCTTGTTTTTTAATGTGTT