ORFeome > pcyt1b ORF1 – XORFeome v1.0

pcyt1b ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: pcyt1b
Gene ID: 6256564
Gene Page ID: 951081
ORF Xenbase ID: 17288391

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC043868
Original XGC clone length: 1101

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11010
Well Location: B11

Sequences - 5ʹ (forward) EST

Accession: JZ823792
dbEST ID: 79641494
Trimmed Sequence: ATGGAAGCCCAAAGCATTACCAAGTCAGTTTCTCGGAAGAGAAGAAAAGATGATATGGGACCTAATGGGACAACAGATGAAGACCCTGTTCCAATAAAGGTTCCCCGCCACACAATGGGAGTGAGAGAGCCTGCACCATTTTCTGATGAGCTGAAGGTAGACCGCAGTAAGCCCTACAGAAGAGTGTCAATGGAGGAGGCAAAAATAGGAACCCCATTGGAACGACCTGTGAGAGTTTATGCTGACGGAATATTTGATCTGTTCCACTCTGGCCATGCACGAGCTTTAATGCAAGCAAAGACTCTCTTTCCAAACACACACTTGATTGTTGGAGTCTGCAGTGATGAACTTACACACAACTTGAAAGGCTTCACTGTGATGAATGAGGCAGAAAGATATGATGCAGTCCAACACTGCCGCTATGTGGATGAGGTGGTAAGGAATGCACCATGGACACTTACCCCTGAATTCCTGGTGAAACACAGGATTGATTTTGTAGCACATGATGATATCCCATACTCTTCTGCGGGAAGCGATGATGTTTATAAGCACATAAAAGATGCAGGGATGTTTGCTCCCACACAGCGGACAGAAGGAATCTCCACCTCTGACATTATCACAAGAATTGTGAGGGATTATGATGTTTACGTACGTCGCAATTTACAGCGTGGATATACTGCCAAAGAGCTTAATGTCAGCTTTATAAATGAGAAACGCTTTAATCTGCAAGAACGCGTGGGATTAAGTGAAGAAAGAAGGGTTAAGGATGTGGAAGGGAAAAGTCCCAAAAAATTTTGTGCCAGAAAGGGGGGA
Full Trace Sequence: TAATGATTTTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGAAGCCCAAAGCATTACCAAGTCAGTTTCTCGGAAGAGAAGAAAAGATGATATGGGACCTAATGGGACAACAGATGAAGACCCTGTTCCAATAAAGGTTCCCCGCCACACAATGGGAGTGAGAGAGCCTGCACCATTTTCTGATGAGCTGAAGGTAGACCGCAGTAAGCCCTACAGAAGAGTGTCAATGGAGGAGGCAAAAATAGGAACCCCATTGGAACGACCTGTGAGAGTTTATGCTGACGGAATATTTGATCTGTTCCACTCTGGCCATGCACGAGCTTTAATGCAAGCAAAGACTCTCTTTCCAAACACACACTTGATTGTTGGAGTCTGCAGTGATGAACTTACACACAACTTGAAAGGCTTCACTGTGATGAATGAGGCAGAAAGATATGATGCAGTCCAACACTGCCGCTATGTGGATGAGGTGGTAAGGAATGCACCATGGACACTTACCCCTGAATTCCTGGTGAAACACAGGATTGATTTTGTAGCACATGATGATATCCCATACTCTTCTGCGGGAAGCGATGATGTTTATAAGCACATAAAAGATGCAGGGATGTTTGCTCCCACACAGCGGACAGAAGGAATCTCCACCTCTGACATTATCACAAGAATTGTGAGGGATTATGATGTTTACGTACGTCGCAATTTACAGCGTGGATATACTGCCAAAGAGCTTAATGTCAGCTTTATAAATGAGAAACGCTTTAATCTGCAAGAACGCGTGGGATTAAGTGAAGAAAGAAGGGTTAAGGATGTGGAAGGGAAAAGTCCCAAAAAATTTTGTGCCAGAAAGGGGGGA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAAGCCCAAAGCATTAC

Sequences - 3ʹ (reverse) EST

Accession: JZ829101
dbEST ID: 79646803
Trimmed Sequence: ATCCTCTTCATCTTCACTGATGTCATAAGTGGCAGCAGTGGGCCGAGAGTGCCTTCCGGGAGATGCAGGAGGAGAGATCTTGGAAAATGGCCAGCGAAACGACGGGGAGGGAGAGCGCTCACGAGTGGGGCTACTGCTGGGGCTTTGCTTTGGACTGATCGCCTGAAGCATTCTCCCTTTGCCTTCCTTCAGCATGTGCTTCAAAGCTCCCTCTGGCCCAAACATCTCTAAAAAGTTTCCAATGAACTCTCGTGATTTTTCCTCCCACTTTTGAATCATATCAATACTCTTCTCTTCCACCTTCTGCACAAATTCTTTGGACTTCTCCTCCACATCTTTAACCTTCTTCTTCACTTTATCCACGCGTTCTTGCAGATTAAAGCGTTTCTCATTTATAAAGCTGACATTAAGCTCTTTGGCAGTATATCCACGCTGTAAATTGCGACGTACGTAAACATCATAATCCCTCACAATTCTTGTGATAATGTCAGAGGTGGAGATTCCTTCTGTCCGCTGTGTGGGAGCAAACATCCCTGCATCTTTTATGTGCTTATAAACATCATCGCTTCCCGCAGAAGAGTATGGGATATCATCATGTGCTACAAAAATCAATCCTGTGTTTCACCAGGAATCCANGGGGTAAGTGTCCAATGGTGCATTCCTTACCACCTCATCCCAATTAGCGGCCGTGGTTGGAATGCATCATATTCTTTTTTGCCCCCTTTCTTCAAAATGAAAACCTTTTTTAAAATTTTGGGGGTTTAAAT
Full Trace Sequence: TGACGTGTATCAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGNCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAATCCTCTTCATCTTCACTGATGTCATAAGTGGCAGCAGTGGGCCGAGAGTGCCTTCCGGGAGATGCAGGAGGAGAGATCTTGGAAAATGGCCAGCGAAACGACGGGGAGGGAGAGCGCTCACGAGTGGGGCTACTGCTGGGGCTTTGCTTTGGACTGATCGCCTGAAGCATTCTCCCTTTGCCTTCCTTCAGCATGTGCTTCAAAGCTCCCTCTGGCCCAAACATCTCTAAAAAGTTTCCAATGAACTCTCGTGATTTTTCCTCCCACTTTTGAATCATATCAATACTCTTCTCTTCCACCTTCTGCACAAATTCTTTGGACTTCTCCTCCACATCTTTAACCTTCTTCTTCACTTTATCCACGCGTTCTTGCAGATTAAAGCGTTTCTCATTTATAAAGCTGACATTAAGCTCTTTGGCAGTATATCCACGCTGTAAATTGCGACGTACGTAAACATCATAATCCCTCACAATTCTTGTGATAATGTCAGAGGTGGAGATTCCTTCTGTCCGCTGTGTGGGAGCAAACATCCCTGCATCTTTTATGTGCTTATAAACATCATCGCTTCCCGCAGAAGAGTATGGGATATCATCATGTGCTACAAAAATCAATCCTGTGTTTCACCAGGAATCCANGGGGTAAGTGTCCAATGGTGCATTCCTTACCACCTCATCCCAATTAGCGGCCGTGGTTGGAATGCATCATATTCTTTTTTGCCCCCTTTCTTCAAAATGAAAACCTTTTTTAAAATTTTGGGGGTTTAAAT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAATCCTCTTCATCTTCACTGATGT