ORFeome > pdcd6 ORF2 – XORFeome v1.0

pdcd6 ORF2 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: pdcd6
Gene ID: 960921
Gene Page ID: 960915
ORF Xenbase ID: 17288439

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC110939
Original XGC clone length: 564

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11085
Well Location: E03

Sequences - 5ʹ (forward) EST

Accession: JZ837698
dbEST ID: 79655400
Trimmed Sequence: ATGGCTTACTACCAGCAGCAGCAGCAGCAGCACCGGCCCCCGGGGAACACCATGCCTGACCAGTCTTTCTTATGGAACGTCTTCCAAAGAGTGGACCGAGACAGAAGCGGTGTTATATCTGACACAGAACTCCAGCAAGCCCTGTCAAATGGTACATGGACACCTTTTAATCCTGCAACTGTGAATTCTATCATATCCATGTTTGACAGGGACCACAAGGGTGGTGTGAACTTCAATGAATTTTCAGGCGTCTGGAAGTACATTACAGACTGGCAGAACATATTCCGAACTTATGACCGAGACAACTCCGGTCTGATTGATAAAAATGAACTAAAGCAAGCTCTGTCAGGTTTTGGGTATCGTCTTTCAGAGCAGTTTTATGATGTCCTCATAAAAAAATTTGACAGGCAAAGGAGAGGGCAAGTTGCCTTTGATGACTTCATTCAGTGCTGCATTGTCCTGCAGCGACTGACTGATGTTTTCAGGCGCTATGACACGGACCAAGATGGCTGGATACAAGTTTCTTATGAGCAGTATCTTACAATGATCTTTAGTGTCGTATT
Full Trace Sequence: TCGAGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCTTACTACCAGCAGCAGCAGCAGCAGCACCGGCCCCCGGGGAACACCATGCCTGACCAGTCTTTCTTATGGAACGTCTTCCAAAGAGTGGACCGAGACAGAAGCGGTGTTATATCTGACACAGAACTCCAGCAAGCCCTGTCAAATGGTACATGGACACCTTTTAATCCTGCAACTGTGAATTCTATCATATCCATGTTTGACAGGGACCACAAGGGTGGTGTGAACTTCAATGAATTTTCAGGCGTCTGGAAGTACATTACAGACTGGCAGAACATATTCCGAACTTATGACCGAGACAACTCCGGTCTGATTGATAAAAATGAACTAAAGCAAGCTCTGTCAGGTTTTGGGTATCGTCTTTCAGAGCAGTTTTATGATGTCCTCATAAAAAAATTTGACAGGCAAAGGAGAGGGCAAGTTGCCTTTGATGACTTCATTCAGTGCTGCATTGTCCTGCAGCGACTGACTGATGTTTTCAGGCGCTATGACACGGACCAAGATGGCTGGATACAAGTTTCTTATGAGCAGTATCTTACAATGATCTTTAGTGTCGTATTGCCTACTTTCTTGTACAAAGTTGGCATTATAAGACAGCATTGCTTATCAATTTGTTGCAACCAACAGGTCACTATCAGTCAAAAATAAATCATTATTTGCCATCCAGCTGATATCCTCTAATGTGAATCGTATTAACATGGTAAAAAAAAAATTCAAAAAAAAACAAAGACAAAGTCTCAAATTCTCCTTAAATTTTAAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCTTACTACCAGCAG

Sequences - 3ʹ (reverse) EST

Accession: JZ837697
dbEST ID: 79655399
Trimmed Sequence: TACGACACTAAAGATCATTGTAAGATACTGCTCATAAGAAACTTGTATCCAGCCATCTTGGTCCGTGTCATAGCGCCTGAAAACATCAGTCAGTCGCTGCAGGACAATGCAGCACTGAATGAAGTCATCAAAGGCAACTTGCCCTCTCCTTTGCCTGTCAAATTTTTTTATGAGGACATCATAAAACTGCTCTGAAAGACGATACCCAAAACCTGACAGAGCTTGCTTTAGTTCATTTTTATCAATCAGACCGGAGTTGTCTCGGTCATAAGTTCGGAATATGTTCTGCCAGTCTGTAATGTACTTCCAGACGCCTGAAAATTCATTGAAGTTCACACCACCCTTGTGGTCCCTGTCAAACATGGATATGATAGAATTCACAGTTGCAGGATTAAAAGGTGTCCATGTACCATTTGACAGGGCTTGCTGGAGTTCTGTGTCAGATATAACACCGCTTCTGTCTCGGTCCACTCTTTGGAAGACGTTCCATAAGAAAGACTGGTCAGGCATGGTGTTCCCCGGGGGCCGGTGCTGCTGCTGCTGCTGCTGGTAGTAAGCCATGG
Full Trace Sequence: GGCCAGGGGAACAGCCACTGAAGCATGTAATACGACTCACTATACGGGGAAACCAGCCTGGATGGCAAATAATGATATTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATACGACACTAAAGATCATTGTAAGATACTGCTCATAAGAAACTTGTATCCAGCCATCTTGGTCCGTGTCATAGCGCCTGAAAACATCAGTCAGTCGCTGCAGGACAATGCAGCACTGAATGAAGTCATCAAAGGCAACTTGCCCTCTCCTTTGCCTGTCAAATTTTTTTATGAGGACATCATAAAACTGCTCTGAAAGACGATACCCAAAACCTGACAGAGCTTGCTTTAGTTCATTTTTATCAATCAGACCGGAGTTGTCTCGGTCATAAGTTCGGAATATGTTCTGCCAGTCTGTAATGTACTTCCAGACGCCTGAAAATTCATTGAAGTTCACACCACCCTTGTGGTCCCTGTCAAACATGGATATGATAGAATTCACAGTTGCAGGATTAAAAGGTGTCCATGTACCATTTGACAGGGCTTGCTGGAGTTCTGTGTCAGATATAACACCGCTTCTGTCTCGGTCCACTCTTTGGAAGACGTTCCATAAGAAAGACTGGTCAGGCATGGTGTTCCCCGGGGGCCGGTGCTGCTGCTGCTGCTGCTGGTAGTAAGCCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAGCGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCGGCCCGAACTAAAGACTGAACGACATTTAAAACTCAATGGACTGGGGGNGGCCGAGGGGAGAGAAAAAGCGGCGGCGCCGGGCGACAAGGGGGGGAGGGGGAAAGAGNAGGGGGGGGGAGAGAAAAACGCCACCGCGGAGGGAGAAGAAAAAAAAAAATATAATAAAAAAAAAAAGAAGAAGGGAGAGGGGAANNGNCNNGNGGNAAAAAAAAAAAAGGAAAAGAGGGGGGGGGAGAGNGGGAGGGTGATTGGTTTGTGTATAGTAGAGTGTTGTTGGTGGNNAGNAACCAGCANAGACGGAAAGGAAAAANAGGGNAGGGAAGGGAGNGAAGAGAGGATAGGANGAAANAGGNGAAANNGAGGANGNGAGGNNANGGGNGGGGNGNNGNNNAGNAGGGGGAGGGGNGGAGGGGGAGGGGGGNGGGGGGGGGGGGAGNGNGGGGGGGAGGNGGANAGNNGGAGNGGGGNGGAGGGGNGANNGGNGGGGGAGGNGGGGGAGGANNGANNNNGNGGNNGGGGGGGGNAGGNNGGNGNNGAAGNNGGGGGGGNNNNNAANNNNNNGAAGGNNGNNNNNNN
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATACGACACTAAAGATCATTGTAAG