ORFeome > pdgfra ORF1 – XORFeome v1.0

pdgfra ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: pdgfra
Gene ID: 6072934
Gene Page ID: 6072919
ORF Xenbase ID: 17288517

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC043948
Original XGC clone length: 3264

Human orthology & disease relationships

NCBI Entrez ID: 5156
Ensembl gene IDs: ENSG00000134853,LRG_309
Directly associated (OMIM) disease MIM numbers: 606764,607685
Indirectly associated (Lage, et al.) disease MIM numbers: 101600,114480,114500,123500,125853,130060,135300,166200,166210,166220,193100,211900,259420,604370,607685,607785,607907,608232,608354,608355,608747,609307

Library Location

Plate ID: GDExl11014
Well Location: E12

Sequences - 5ʹ (forward) EST

Accession: #N/A
dbEST ID: #N/A
Trimmed Sequence: #N/A
Full Trace Sequence: GAAAAAAATGAGTTAATTTTTTTTTATTATGATTAATAGTCGACCTGGTTCGGATGATATAAGATTGAGAGAGGCAATTGTTTGTTTTATACCTTCCGTACTTATATACAAAATTAGTCTGGGACCCTGCATGGGGGTGAACCATGCACTTTCGCTCTGATGGCCCACTTTGGTCTCCTGAGAGGGGGGCCTAGAAGTAAAGTTCTCAGTAGCCACATTACGTCCCTACGAATTCACCTTCCGACCTCCCACTTTGCGTGAAAAAGAGCCATTGCCGCGGAGTGCAATCCGCGGCCCCCTATGAACGGTGAAATGGCCCCGAGGCAGTTGCGTCATGCGGAACTGTTAGACACCCTCCTACCACCGCGGGCAGAATCTTGATCTCAATACCTTCTCTAATCGGAAACCAGAAGAACAACCACCCCTTATGTGGCCATATTCGAAAAAGAGTGCCCTGCAGACCTCCTGCAGGTGCAGTAAGGATCGAGACTGCCAGCACGCGTGTCTCCATACACGTACAGTAGACGATGCACCCAATGGCGCATAATTATTAGCTGACTTCTTTTATTCACACCACAAATATCCTGCCACTGCGCCCGGCCTGGGGTTTACTCGCTATAAATCAGCTAGGGGGAGAGAGAATATACACTCACGGCGGGGGGAACACCGCCTCAAGCGCCCCCCCCAATGGGGGAAAAAGAAGAGACGGGACTTTTGAAAACCGGGCTCAAGCGATACCCCCCCTTTATTAAAATAACCACAAGCACGGGAGGGTAAGGAGAAAGTCCCCCCTCTTGGCGTTCACCCCATAAATTCACCATTACCACAAACATGGAGGCTAAAAAAAAACCGCACCTGTCTTCTTTTGGGAGGGTGGAGCACAAAATTTTCAAGATTTTTTTCTCTCAAAATCCCAACCCCCACACGTATATTTTATCGAAGGGGGGGAAAAAAAATTTTTTTAAAGGTGGGGGTTTGGGCGGGGGAGACCAAAGGGGAGGGGGGGGTCACGGGAGGGCCCCCCCCATCCCGAGAGAGAAAGGGGGGTGAGGGGAAGTTTTTGTGTATTTT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGATGCCTGCCATGAGGG

Sequences - 3ʹ (reverse) EST

Accession: JZ829552
dbEST ID: 79647254
Trimmed Sequence: CAGGAAACTGTCCTCCACTAGATCCGAGGGATCAATCCCAATGTCGTCCATCATCTCAATGTCTTCAATGGTCTCATCCTCCCTCTTTATAAAAGTGGAACTGCTGGAACCAGTCTCGATTGCACTTTCTTCTGATGTCTGAGAACTGTGCCTGTTCCTCTTGCCAGACTCATCATCTGAGACGGGGTCAATATCGGGAAGGGGAATAATGTAACCGCTGTCAGCACTCAGCCTCTGCTCATCAAATCCGCTTTCTCTGTCCTTCATTTTGTGTTCATTCTTATACGTCACCCCAATGTAGGAATTGTCACTGTCACTTCTCATGCGGGTAACTGCAGGGTGGTCACTTTTAAGGAAGTCGTGAAGAACTGTCTCGTAGCACCTTTTGTATTCCGTGGGAAGTAGACTTTCAACAATGTCACTCAGATGGCCAAATGATGGCCTTTTCTCTGGTTCGCTGTTCCAGCATTTTACCATGATGTCATACACTTCATGGGTGGCATGGTCAGGTTTTGTCATTCTGTAGCCACTTTTTATCTTATTATAGAAAGTTGAGTCTACAATCATGCCAGGGTATGGTGTGCCACCAAGAGAGAATATTTCCCATAGCAGGATCCCAAATGACCACACATCACTGAGAGTTGTGTACAAGTTATCGAAGATGCTTTCAGGTGCCATCCACTTCACAGGGAAGGAAAGTGCTGCCTTTTGGATACGTAAGTG
Full Trace Sequence: TGCCGGGTATCAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACAGGAAACTGTCCTCCACTAGATCCGAGGGATCAATCCCAATGTCGTCCATCATCTCAATGTCTTCAATGGTCTCATCCTCCCTCTTTATAAAAGTGGAACTGCTGGAACCAGTCTCGATTGCACTTTCTTCTGATGTCTGAGAACTGTGCCTGTTCCTCTTGCCAGACTCATCATCTGAGACGGGGTCAATATCGGGAAGGGGAATAATGTAACCGCTGTCAGCACTCAGCCTCTGCTCATCAAATCCGCTTTCTCTGTCCTTCATTTTGTGTTCATTCTTATACGTCACCCCAATGTAGGAATTGTCACTGTCACTTCTCATGCGGGTAACTGCAGGGTGGTCACTTTTAAGGAAGTCGTGAAGAACTGTCTCGTAGCACCTTTTGTATTCCGTGGGAAGTAGACTTTCAACAATGTCACTCAGATGGCCAAATGATGGCCTTTTCTCTGGTTCGCTGTTCCAGCATTTTACCATGATGTCATACACTTCATGGGTGGCATGGTCAGGTTTTGTCATTCTGTAGCCACTTTTTATCTTATTATAGAAAGTTGAGTCTACAATCATGCCAGGGTATGGTGTGCCACCAAGAGAGAATATTTCCCATAGCAGGATCCCAAATGACCACACATCACTGAGAGTTGTGTACAAGTTATCGAAGATGCTTTCAGGTGCCATCCACTTCACAGGGAAGGAAAGTGCTGCCTTTTGGATACGTAAGTG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACAGGAAACTGTCCTCCACTA