ORFeome > pdia3 ORF1 – XORFeome v1.0

pdia3 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: pdia3
Gene ID: 976334
Gene Page ID: 976327
ORF Xenbase ID: 17288571

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC046707
Original XGC clone length: 1509

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11014
Well Location: F10

Sequences - 5ʹ (forward) EST

Accession: JZ824169
dbEST ID: 79641871
Trimmed Sequence: ATGAACCGGCAACTCCTCGGCGCCTTCTTCCTCCTCCTGGCTGTCACCGCCGGCACTCAGGCCGCAGGTTCAGATGTCCTGGATCTCACCGACGATAACTTTGAAAGCGTCGTAGCTCAGCACAGCATCTTGCTAGTGGAGTTCTTCGCTCCCTGGTGTGGTCATTGTAAGAAACTAGCTCCTGAATATGAAATTGCAGCCACTAAGCTTAAAGGGACACTTTCTTTGGCTAAGGTTGACTGCACAGCCAATTCCAACATTTGCAACAAATATGGAGTCAGTGGATACCCTACTCTAAAAATATTCAGAGATGGAGAGGACTCTGGATCTTACGATGGGCCAAGATCTGCTGATGGAATTGTTAGTACTATGAAGAAACAAGCTGGACCAGCATCAGTAGATCTCCGATCTGTTGAGGAATTTGAAAAATTTGTTGCTGATAAAGATGCTGCTGTGGTCGGATTTTTCCGGGACTTGTATAGTGGCCCTCACTCTGAGTTTCTTAAAGCTGCAAACACCCTTAGAGAGAACTATCGCTTTGCTCACACAGATGAAAAAGAGCTTGTGGACAAATATGATACANATGGANGAGGGTGTTGTCTTGTTCCGCCCACCACACCTGGCAAACAAATTTGAAGACGGCTCTGTGACATTCCCTGCTGATGAGAAAATAACCAGCGGCAAAATTAAAAAGTTCATTTCAGATAAACATTTTTGGGTCTCTGCCCTCACTTGACACAGAACAACAAAGATTTGATCCCAAGGAAAGGACTTGCTAATTCCCAATTTATTAAAGTGAACCTTTAAAAAGAAAGTTTAAGGGGGTACCAAATATTTGGGA
Full Trace Sequence: AATAGTGGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAACCGGCAACTCCTCGGCGCCTTCTTCCTCCTCCTGGCTGTCACCGCCGGCACTCAGGCCGCAGGTTCAGATGTCCTGGATCTCACCGACGATAACTTTGAAAGCGTCGTAGCTCAGCACAGCATCTTGCTAGTGGAGTTCTTCGCTCCCTGGTGTGGTCATTGTAAGAAACTAGCTCCTGAATATGAAATTGCAGCCACTAAGCTTAAAGGGACACTTTCTTTGGCTAAGGTTGACTGCACAGCCAATTCCAACATTTGCAACAAATATGGAGTCAGTGGATACCCTACTCTAAAAATATTCAGAGATGGAGAGGACTCTGGATCTTACGATGGGCCAAGATCTGCTGATGGAATTGTTAGTACTATGAAGAAACAAGCTGGACCAGCATCAGTAGATCTCCGATCTGTTGAGGAATTTGAAAAATTTGTTGCTGATAAAGATGCTGCTGTGGTCGGATTTTTCCGGGACTTGTATAGTGGCCCTCACTCTGAGTTTCTTAAAGCTGCAAACACCCTTAGAGAGAACTATCGCTTTGCTCACACAGATGAAAAAGAGCTTGTGGACAAATATGATACANATGGANGAGGGTGTTGTCTTGTTCCGCCCACCACACCTGGCAAACAAATTTGAAGACGGCTCTGTGACATTCCCTGCTGATGAGAAAATAACCAGCGGCAAAATTAAAAAGTTCATTTCAGATAAACATTTTTGGGTCTCTGCCCTCACTTGACACAGAACAACAAAGATTTGATCCCAAGGAAAGGACTTGCTAATTCCCAATTTATTAAAGTGAACCTTTAAAAAGAAAGTTTAAGGGGGTACCAAATATTTGGGA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAACCGGCAACTCCTC

Sequences - 3ʹ (reverse) EST

Accession: JZ829474
dbEST ID: 79647176
Trimmed Sequence: TAACTCTTCCTTCTTCTTCTTTTTGGGTTTTTCATCTTCCTTAACGACTGGAGGGTTTGTTGCCTCCTTCTTCAGATAGCTAAGGAACTCGCTCACCTCTCTACCACCCTCATATCTCTTTGGGTTTTGCTTATTTCCTGCAGGAGCAAAGTAAATTGTGGGGAACCCTCTAACTTCATATTGAGGAGGCACATCGTTTGCTGTGGCATCCATCTTGGCAATCACAATGTTTGGATCATCGGCAAGCTTCTCTCCAAGTTCTTTGTATTTAGGTTCCAAGGTCTTACAATGGCCACACCATGGAGCATAGAACTCAATTAGTACATCTTTGCTTTCATCGTTGACAAGTTCGTCAAAGTTTTCAGCTACCGCCACCTTAACAGGCCCGTCGTTACTTTCAGGGATGGATTCAGATTTCATGTATCTCTTCAGTTTACCATCAAAATAATCCTGAAGGAATCTTTCCAAAGCTTTTCCATCACGGGAGAATTCTTCTTGCATGACAAATTTCTCGCCTTTAGCAGTTTTGATTCCAACAACAGGAAGTTCCCCAGTATTGGCATCCAAACCAAATTCTGTCACTTCATGTCCAAAGGATTTCCGGTTAGCAACAGCAAAATTTAGTTTTTTTGCCAGCATCAACCAAAGAACTTTGCAACTTTCATTACTCTGTTTCCGCCAATAATTGGGTAACCCCTTGACATTTCTTTTTCATAATTCAAACATCAAAAATAATGGCGAATAAAGCCAAGTCCC
Full Trace Sequence: CCGACAGGAAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATAACTCTTCCTTCTTCTTCTTTTTGGGTTTTTCATCTTCCTTAACGACTGGAGGGTTTGTTGCCTCCTTCTTCAGATAGCTAAGGAACTCGCTCACCTCTCTACCACCCTCATATCTCTTTGGGTTTTGCTTATTTCCTGCAGGAGCAAAGTAAATTGTGGGGAACCCTCTAACTTCATATTGAGGAGGCACATCGTTTGCTGTGGCATCCATCTTGGCAATCACAATGTTTGGATCATCGGCAAGCTTCTCTCCAAGTTCTTTGTATTTAGGTTCCAAGGTCTTACAATGGCCACACCATGGAGCATAGAACTCAATTAGTACATCTTTGCTTTCATCGTTGACAAGTTCGTCAAAGTTTTCAGCTACCGCCACCTTAACAGGCCCGTCGTTACTTTCAGGGATGGATTCAGATTTCATGTATCTCTTCAGTTTACCATCAAAATAATCCTGAAGGAATCTTTCCAAAGCTTTTCCATCACGGGAGAATTCTTCTTGCATGACAAATTTCTCGCCTTTAGCAGTTTTGATTCCAACAACAGGAAGTTCCCCAGTATTGGCATCCAAACCAAATTCTGTCACTTCATGTCCAAAGGATTTCCGGTTAGCAACAGCAAAATTTAGTTTTTTTGCCAGCATCAACCAAAGAACTTTGCAACTTTCATTACTCTGTTTCCGCCAATAATTGGGTAACCCCTTGACATTTCTTTTTCATAATTCAAACATCAAAAATAATGGCGAATAAAGCCAAGTCCC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATAACTCTTCCTTCTTCTTCTTCTT