ORFeome > pdlim1 ORF1 – XORFeome v1.0

pdlim1 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: pdlim1
Gene ID: 1004697
Gene Page ID: 1004690
ORF Xenbase ID: 17288619

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC054254
Original XGC clone length: 978

Human orthology & disease relationships

NCBI Entrez ID: 9124
Ensembl gene IDs: ENSG00000107438
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 123400,137440,137600,180500,203450,245300,600072,600652,603218,603278,604229,606688,607841

Library Location

Plate ID: GDExl11003
Well Location: C04

Sequences - 5ʹ (forward) EST

Accession: JZ839435
dbEST ID: 79657137
Trimmed Sequence: ATGGCTACTAAACGTGTCCTAATGACTGGACCTTCACCTTGGGGATTTCGGCTGATTGGAGGGAAAGATTTCGAACAACCCTTAACTATTTCCAGGGTAATGCCAGGAAGCAAAGCTGCAGTTGCGGAACTATGTACAGGAGACGTAGTCATTGCTATTGATGGGGAAAACACAGATGGGATGACTCATTTAGAAGCGCAGAATAAAATTAAAGGCTGTGAAGATGAATTAATTCTTACGATAAACAGGGTTGAATCAAAAATATGGTCTCCTCTTGTCTCTGAAGATGGAAAACCAAATCCATATAAGATGAACTTGGCAAGTAACCCACAGGAATTAAAACAAATAGGAACTGCACACAATCGAAGTGCTATGCCGTTCACTGCTGCCTCAGCTTCCAGCACCCCCAAAGTGATCACTGCTCAGTACAACAACCCAGCCGGCCTCTATTCTTCCGACAACATACAGGACTTCAATAGTGCTCTGGAAACCAAAGCCACTTCCAGTGCCCCAGCACCAAGCAAAGCTGCAGAACAAACACAGCCAGCANATACTCAACACATTGATNAGGACTCCGAAGTTTACAAGATGCTGNCAGAGAATCGAGAATCAGAGGAACCCCCTAGGCAGTCGGCTTTCTTTCTTGTCCTGCAGGAAATCTTGGAAACGGATGAGAAAGGGGAAAAACATCAGGGTTCCGGAGCGTAAGGGCACCCACCATAAAGTCCCCCCCTCTTTGGGACTTGAACAAAACTGGCAATTTTTGAACCATGGTGGCTAAGGCCTTGTGGGAAACCTTTTGGGAAATATTGGGAAAAACCCCCTCCCACCC
Full Trace Sequence: GACCCCATATAATAGAATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCTACTAAACGTGTCCTAATGACTGGACCTTCACCTTGGGGATTTCGGCTGATTGGAGGGAAAGATTTCGAACAACCCTTAACTATTTCCAGGGTAATGCCAGGAAGCAAAGCTGCAGTTGCGGAACTATGTACAGGAGACGTAGTCATTGCTATTGATGGGGAAAACACAGATGGGATGACTCATTTAGAAGCGCAGAATAAAATTAAAGGCTGTGAAGATGAATTAATTCTTACGATAAACAGGGTTGAATCAAAAATATGGTCTCCTCTTGTCTCTGAAGATGGAAAACCAAATCCATATAAGATGAACTTGGCAAGTAACCCACAGGAATTAAAACAAATAGGAACTGCACACAATCGAAGTGCTATGCCGTTCACTGCTGCCTCAGCTTCCAGCACCCCCAAAGTGATCACTGCTCAGTACAACAACCCAGCCGGCCTCTATTCTTCCGACAACATACAGGACTTCAATAGTGCTCTGGAAACCAAAGCCACTTCCAGTGCCCCAGCACCAAGCAAAGCTGCAGAACAAACACAGCCAGCANATACTCAACACATTGATNAGGACTCCGAAGTTTACAAGATGCTGNCAGAGAATCGAGAATCAGAGGAACCCCCTAGGCAGTCGGCTTTCTTTCTTGTCCTGCAGGAAATCTTGGAAACGGATGAGAAAGGGGAAAAACATCAGGGTTCCGGAGCGTAAGGGCACCCACCATAAAGTCCCCCCCTCTTTGGGACTTGAACAAAACTGGCAATTTTTGAACCATGGTGGCTAAGGCCTTGTGGGAAACCTTTTGGGAAATATTGGGAAAAACCCCCTCCCACCC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCTACTAAACGTGTCCT

Sequences - 3ʹ (reverse) EST

Accession: JZ839434
dbEST ID: 79657136
Trimmed Sequence: TTTGGGGAACACGGTGACCACGTCGTATCCCTCAGGCGGTGTCATGCGTTCCCGTGCGTGCTTCTCACAGTACATCGTGTCTTCTACAAAGAAGTGGCCCTTTTGCTTGAGATTCATGCCGCAGTCAGTGCACACGTAGCATTCAGGGTGACGAGGTTTGTCCCGAATCTTCACAAATGCTCCCACAATGCCTGAGCCACAGTGATCACAAATCTGCAGTTTTTGTCCACTTCCCAAAGAGGCGGCGACTTTATTGGTGGGTGCCCTTACGCTCCGGAACCCTGATGGTTTTTCCCCTTTCTCATCGGTTTCCAAGATTTCCTGCAGGACCAAGAAAGAAGCCGACTGCCTAGGGGGTTCCTCTGATTCTCGATTCTCTTGCAGCATCTTGTAAACTTCGGAGTCTTTATCAATGTGTTGAGTATTTGCTGGCTGTGTTTGTTCTGCAGCTTTGCTTGGTGCTGGGGCACTGGAAGTGGCTTTGGTTTCCAGAGCACTATTGAAGTCCTGTATGTTGTCGGAAGAATAAAGGCCGGCTGGGTTGTTGTACTGAGCAGTGATCACTTTGGGGGTGCTGGAAGCCTGAAGCCGCAGTGAACGGCATAGCACCTTACATGGGTGCAATTCCTAATTGTTTTAAATTCCCTGGGGTTTCCGTGCCCAGGTCCGCTTTAAATGGGAATTTGGTTTTCCATCTTTCGGAAAACAAGAGAAAAACCAAATTTTTGGATTTCAACCCCGGTGTGAGCGGGGTAGGAAGTAGAGGTAATGCTTTCCGGAAGGGCC
Full Trace Sequence: GAAACGGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTTGGGGAACACGGTGACCACGTCGTATCCCTCAGGCGGTGTCATGCGTTCCCGTGCGTGCTTCTCACAGTACATCGTGTCTTCTACAAAGAAGTGGCCCTTTTGCTTGAGATTCATGCCGCAGTCAGTGCACACGTAGCATTCAGGGTGACGAGGTTTGTCCCGAATCTTCACAAATGCTCCCACAATGCCTGAGCCACAGTGATCACAAATCTGCAGTTTTTGTCCACTTCCCAAAGAGGCGGCGACTTTATTGGTGGGTGCCCTTACGCTCCGGAACCCTGATGGTTTTTCCCCTTTCTCATCGGTTTCCAAGATTTCCTGCAGGACCAAGAAAGAAGCCGACTGCCTAGGGGGTTCCTCTGATTCTCGATTCTCTTGCAGCATCTTGTAAACTTCGGAGTCTTTATCAATGTGTTGAGTATTTGCTGGCTGTGTTTGTTCTGCAGCTTTGCTTGGTGCTGGGGCACTGGAAGTGGCTTTGGTTTCCAGAGCACTATTGAAGTCCTGTATGTTGTCGGAAGAATAAAGGCCGGCTGGGTTGTTGTACTGAGCAGTGATCACTTTGGGGGTGCTGGAAGCCTGAAGCCGCAGTGAACGGCATAGCACCTTACATGGGTGCAATTCCTAATTGTTTTAAATTCCCTGGGGTTTCCGTGCCCAGGTCCGCTTTAAATGGGAATTTGGTTTTCCATCTTTCGGAAAACAAGAGAAAAACCAAATTTTTGGATTTCAACCCCGGTGTGAGCGGGGTAGGAAGTAGAGGTAATGCTTTCCGGAAGGGCC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTTGGGGAACACGGTGAC