ORFeome > pdlim7 ORF1 – XORFeome v1.0

pdlim7 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: pdlim7
Gene ID: 6253624
Gene Page ID: 5860424
ORF Xenbase ID: 17288643

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC054240
Original XGC clone length: 672

Human orthology & disease relationships

NCBI Entrez ID: 9260
Ensembl gene IDs: ENSG00000196923
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 108120,215600,609285

Library Location

Plate ID: GDExl11003
Well Location: H01

Sequences - 5ʹ (forward) EST

Accession: JZ839477
dbEST ID: 79657179
Trimmed Sequence: ATGGAGGAATACAAGGTGACTCTGGATGGGCCAGCCCCGTGGGGCTTCCGACTGCAAGGAGGCAAGGATTTTAACATGCCCCTGTCCATCTCTCGGCTCACTCCAGGGGGAAAGTCAGAGCTGGCTGGAGTCAATGTGGGGGATTGGCTGCTTCAGATTGAGGGTGACAGCACGGCATCAATGACTCATATTGAAGCGCAGAACAAGATCAGAGCCAGCAGCAACAAACTGGGCCTTGTCCTGAGCAGATTTGCTGTAGGTGCGAATCATCCCAAGGTGGAGCAAGTAGTAAAGGTTGCCACAAAACCCAAAGTGCAGAATTTGCCCAAGACCTTGAACGGGCTGACCCAATCAAATCTGAACGCTTGTTTCTTTGACGATCAACACTCTCTGAGAATGGAAACACATCCGGCCATTATCCCCAATGACTCCAGCAAAAGGAGACTTATGGAGGATACTCAGGACTGGAAGCCACGCACAGGCACCACCCAGTCCCGCTCCTTCCGTATCTTGGCACAACTTACAGGCACAGACTTCATGCAAGACCCAGATGATGAGAACATGAAAAGGGTGAGGGAAAAGTTCGTCACAGAGCTGCAGAGCCCCCGATACACCCGCTTGAGAGACTGGCACCACGAGAGATCAGCCTGCTCCCTGAATGTGAAACCTTTTGCA
Full Trace Sequence: TCGTGGCCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGAGGAATACAAGGTGACTCTGGATGGGCCAGCCCCGTGGGGCTTCCGACTGCAAGGAGGCAAGGATTTTAACATGCCCCTGTCCATCTCTCGGCTCACTCCAGGGGGAAAGTCAGAGCTGGCTGGAGTCAATGTGGGGGATTGGCTGCTTCAGATTGAGGGTGACAGCACGGCATCAATGACTCATATTGAAGCGCAGAACAAGATCAGAGCCAGCAGCAACAAACTGGGCCTTGTCCTGAGCAGATTTGCTGTAGGTGCGAATCATCCCAAGGTGGAGCAAGTAGTAAAGGTTGCCACAAAACCCAAAGTGCAGAATTTGCCCAAGACCTTGAACGGGCTGACCCAATCAAATCTGAACGCTTGTTTCTTTGACGATCAACACTCTCTGAGAATGGAAACACATCCGGCCATTATCCCCAATGACTCCAGCAAAAGGAGACTTATGGAGGATACTCAGGACTGGAAGCCACGCACAGGCACCACCCAGTCCCGCTCCTTCCGTATCTTGGCACAACTTACAGGCACAGACTTCATGCAAGACCCAGATGATGAGAACATGAAAAGGGTGAGGGAAAAGTTCGTCACAGAGCTGCAGAGCCCCCGATACACCCGCTTGAGAGACTGGCACCACGAGAGATCAGCCTGCTCCCTGAATGTGAAACCTTTTGCAACTTTCTTGTACAAAGTTGGCATTAATAAAAAAGCATTGCTTTAACATTTTGTTGCAACGAAACGGGTCCAACTATAATTCAAAAATAAATCAATTAATTTGCCCACCCAAAAATAAAAAACACACAAAATAAAGAGAAAAAAAAAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAGGAATACAAGGTGAC

Sequences - 3ʹ (reverse) EST

Accession: JZ839476
dbEST ID: 79657178
Trimmed Sequence: AGGCTTCACATTCAGGGAGCAGGCTGATCTCTCGTGGTGCCAGTCTCTCAAGCGGGTGTATCGGGGGCTCTGCAGCTCTGTGACGAACTTTTCCCTCACCCTTTTCATGTTCTCATCATCTGGGTCTTGCATGAAGTCTGTGCCTGTAAGTTGTGCCAAGATACGGAAGGAGCGGGACTGGGTGGTGCCTGTGCGTGGCTTCCAGTCCTGAGTATCCTCCATAAGTCTCCTTTTGCTGGAGTCATTGGGGATAATGGCCGGATGTGTTTCCATTCTCAGAGAGTGTTGATCGTCAAAGAAACAAGCGTTCAGATTTGATTGGGTCAGCCCGTTCAAGGTCTTGGGCAAATTCTGCACTTTGGGTTTTGTGGCAACCTTTACTACTTGCTCCACCTTGGGATGATTCGCACCTACNGCAAATCTGCTCAGGACAAGGCCCAGTTTGTTGCTGCTGGCTCTGATCTTGTTCTGCGCTTCAATATGAGTCATTGATGCCGTGCTGTCACCCTCAATCTGAAGCAGCCGATCCCCCCCATTGACTCCAGCCCGCTCTGACTTTCCCCCTGAAGTGAACCGAGAGAAGGACAGGGGCATGTTAAAATCCTTGCCTCCTTGCATTCGGAACCCCCACGGGGCTGGGCCATCCAAAATCCACTTGAAATTCCTCCCTGG
Full Trace Sequence: GGCAAAAGGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAGGCTTCACATTCAGGGAGCAGGCTGATCTCTCGTGGTGCCAGTCTCTCAAGCGGGTGTATCGGGGGCTCTGCAGCTCTGTGACGAACTTTTCCCTCACCCTTTTCATGTTCTCATCATCTGGGTCTTGCATGAAGTCTGTGCCTGTAAGTTGTGCCAAGATACGGAAGGAGCGGGACTGGGTGGTGCCTGTGCGTGGCTTCCAGTCCTGAGTATCCTCCATAAGTCTCCTTTTGCTGGAGTCATTGGGGATAATGGCCGGATGTGTTTCCATTCTCAGAGAGTGTTGATCGTCAAAGAAACAAGCGTTCAGATTTGATTGGGTCAGCCCGTTCAAGGTCTTGGGCAAATTCTGCACTTTGGGTTTTGTGGCAACCTTTACTACTTGCTCCACCTTGGGATGATTCGCACCTACNGCAAATCTGCTCAGGACAAGGCCCAGTTTGTTGCTGCTGGCTCTGATCTTGTTCTGCGCTTCAATATGAGTCATTGATGCCGTGCTGTCACCCTCAATCTGAAGCAGCCGATCCCCCCCATTGACTCCAGCCCGCTCTGACTTTCCCCCTGAAGTGAACCGAGAGAAGGACAGGGGCATGTTAAAATCCTTGCCTCCTTGCATTCGGAACCCCCACGGGGCTGGGCCATCCAAAATCCACTTGAAATTCCTCCCTGGTGCCACTTTTTTTGTACAAAGTTTGGCATTATAAAAAAAACATTGCTCATCAAATTTTGAAAAAAAAAAAAAAAAAACAAAAAAAAGGAAAAAAAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAGGCTTCACATTCAGGGAGCA