ORFeome > pdp2 ORF1 – XORFeome v1.0

pdp2 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: pdp2
Gene ID: 6252783
Gene Page ID: 480917
ORF Xenbase ID: 17288661

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC123231
Original XGC clone length: 1047

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11088
Well Location: E06

Sequences - 5ʹ (forward) EST

Accession: JZ838222
dbEST ID: 79655924
Trimmed Sequence: ATGTCAAGAACTGTTTCTGGTTGGATTCTGAAGTCTGCAAAACAAAGCGTAAATGTGATCCACAGAGAGAAACGTCACTATTCCAAATGCCTCCTGACTCAACAGCAAGTTAAATGGAGGAGTCCAAGTAGATCTAAGGCAGTGTTTCAGAAGTGGCTTTGTTATCCTGTACATGAAATCAACTTTTCAGGAGAGAGATCTTTTAGGCAAACTTCTTCAGAAAATGATGTGCAATTCTTGTTAAGCCCATCTCAAATTAACTACATACTTAGGGCAAATGAGCTGTCCTACAAGCCAGTAGAGTTTGATGGGAAGAATCCAAGCACTGTCTTCAAGTTTGAGAGCAATCAGCTGGCTTCTAATACACCATGTGAGGACCGCAGGAGTGCAGCAACGTGCCTGCAAACCAACGGGCATTTTTTTGGAGTTTTTGATGGTCATGCTGGATCTGCATGCGCTCAATCAGTTGGCGAGCGGTTGTTTTACTACATTGCTGTCTCTCTGATGTCTCAGAAAACTCTTGAGGATATCGAGTTTGCCAGTGAACACGTGAAACCAATGCTTCCAATTCTCCAGTGGCACAGACACAAAGATGATCACCTTTATAGGGAAGGGGCTTCCCTCTATATAGACCATCTCCCTGTTTATTGGCAAGAGCTGATTAATCTAAAACACGAAACTGGGATGGAGTGTGGATGATGCTATGGTGTATGCATTCCCAAAATTGGAATTCTGAAATCTCCCTTGAAACACCGGTTGCCCAACTGAAGAAAGAAATTTTTAAAAAACCTCCACTTCTTCAAATTTTGCATTTTTCAGGGGGG
Full Trace Sequence: CGCGGGCCCAAATAATGGATTTTANTTTTGACTGATAGNTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTCAAGAACTGTTTCTGGTTGGATTCTGAAGTCTGCAAAACAAAGCGTAAATGTGATCCACAGAGAGAAACGTCACTATTCCAAATGCCTCCTGACTCAACAGCAAGTTAAATGGAGGAGTCCAAGTAGATCTAAGGCAGTGTTTCAGAAGTGGCTTTGTTATCCTGTACATGAAATCAACTTTTCAGGAGAGAGATCTTTTAGGCAAACTTCTTCAGAAAATGATGTGCAATTCTTGTTAAGCCCATCTCAAATTAACTACATACTTAGGGCAAATGAGCTGTCCTACAAGCCAGTAGAGTTTGATGGGAAGAATCCAAGCACTGTCTTCAAGTTTGAGAGCAATCAGCTGGCTTCTAATACACCATGTGAGGACCGCAGGAGTGCAGCAACGTGCCTGCAAACCAACGGGCATTTTTTTGGAGTTTTTGATGGTCATGCTGGATCTGCATGCGCTCAATCAGTTGGCGAGCGGTTGTTTTACTACATTGCTGTCTCTCTGATGTCTCAGAAAACTCTTGAGGATATCGAGTTTGCCAGTGAACACGTGAAACCAATGCTTCCAATTCTCCAGTGGCACAGACACAAAGATGATCACCTTTATAGGGAAGGGGCTTCCCTCTATATAGACCATCTCCCTGTTTATTGGCAAGAGCTGATTAATCTAAAACACGAAACTGGGATGGAGTGTGGATGATGCTATGGTGTATGCATTCCCAAAATTGGAATTCTGAAATCTCCCTTGAAACACCGGTTGCCCAACTGAAGAAAGAAATTTTTAAAAAACCTCCACTTCTTCAAATTTTGCATTTTTCAGGGGGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCAAGAACTGTTTCTGGTTGG

Sequences - 3ʹ (reverse) EST

Accession: JZ838221
dbEST ID: 79655923
Trimmed Sequence: TTGCATTAAAATACCCAACAACCTATTATCTGTCACTATGGTATCTTTTTCAGATGGTGGGTGTTCAGCATGTAATCTTTGGAGCTCAGCTTTATTAAAGGCATTGTGATCTGCTGTAAGAGGAACCGCTGACCAAGTTCCACTGTCATTCTGAACACCTAAGATGGCCCGGCAGTCACCAGCATTAGCTATGTGCAAATGAACTCCATCGACATGAGACACACATGCTGTTGCCCCTGAAAATGCAACTTGCAGAGTGAGGTTTCTGAGAAATTCATCATCAGTGGGCACCTGTGCTTCAAGGGAGATGTCAGAATCCAATCTTTGGAATGCATACACCATAGCATCATCCACACTCATTCCAGTTTCGTTGTCTAGATTAATCAGCTCTTGCCAATAAACACGGAGATGGTCTATATAGAGGGAAGCCCCTTCCCTATAAAGGTGATCATCCTTGTGTTTGTGCCACTGGAGAATTGGAAGCATTGGTTTCACGTGTTCACTGGCAAACTCGATATCCTCAAGAGTTTTCTGAGACATCAGAGAGACAGCAATGTAGTAGAACAACCGCTCGCCCACTGATTGAGCGCATGCAGATCCCGCATGACCATTCAAAACTCCCAAAAAATGCCCCTTTGGTTTGCAGGGACGTTGCTGCACTCCTGCGGTCCCTCCATGGTGGAATAAAAAACCAACCTGAATTGCTCCCAAACTTTGAAAACCGGGTCCTGGGAAATTCTTTCCCCATCCAAACTCC
Full Trace Sequence: GGAAACCTGCTAGTGACCATGTAATACGACTCACTATAGGGGGATATCNAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTGCATTAAAATACCCAACAACCTATTATCTGTCACTATGGTATCTTTTTCAGATGGTGGGTGTTCAGCATGTAATCTTTGGAGCTCAGCTTTATTAAAGGCATTGTGATCTGCTGTAAGAGGAACCGCTGACCAAGTTCCACTGTCATTCTGAACACCTAAGATGGCCCGGCAGTCACCAGCATTAGCTATGTGCAAATGAACTCCATCGACATGAGACACACATGCTGTTGCCCCTGAAAATGCAACTTGCAGAGTGAGGTTTCTGAGAAATTCATCATCAGTGGGCACCTGTGCTTCAAGGGAGATGTCAGAATCCAATCTTTGGAATGCATACACCATAGCATCATCCACACTCATTCCAGTTTCGTTGTCTAGATTAATCAGCTCTTGCCAATAAACACGGAGATGGTCTATATAGAGGGAAGCCCCTTCCCTATAAAGGTGATCATCCTTGTGTTTGTGCCACTGGAGAATTGGAAGCATTGGTTTCACGTGTTCACTGGCAAACTCGATATCCTCAAGAGTTTTCTGAGACATCAGAGAGACAGCAATGTAGTAGAACAACCGCTCGCCCACTGATTGAGCGCATGCAGATCCCGCATGACCATTCAAAACTCCCAAAAAATGCCCCTTTGGTTTGCAGGGACGTTGCTGCACTCCTGCGGTCCCTCCATGGTGGAATAAAAAACCAACCTGAATTGCTCCCAAACTTTGAAAACCGGGTCCTGGGAAATTCTTTCCCCATCCAAACTCC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTGCATTAAAATACCCAACAACCT