ORFeome > pebp4 ORF1 – XORFeome v1.0

pebp4 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: pebp4
Gene ID: 941754
Gene Page ID: 941750
ORF Xenbase ID: 17288715

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC078524
Original XGC clone length: 609

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11005
Well Location: D01

Sequences - 5ʹ (forward) EST

Accession: JZ839920
dbEST ID: 79657622
Trimmed Sequence: ATGGCCAGGACGTGGTTCCTACTCTTGGGTATCCTGTCTCTGACCGCTCGTTTCAATACACTACAGGCTGAAGAATGTTCCATAAGGAAACTCTTCAATGGTGAGGATGAAAAATTCTGCAGTAAAGGTTTAGATATTATATATTCAGATATTGGCCTAGTGTCCTGCATCTATATCCCCAACTGCTTTGACTTTTCTTGGAGCCTCTCCAAAGTGTGGGAACATCCTTTAGTCAGATACTCCAAAGCCCAACCGGGAGTAAAATACGTCCTGATTATGGTAGATTCAGATGCACCGTCCCGATGGGACCCCAAATACAGATACTGGAGGCACTGGCTGCTTACTGATATACCGGGCTGGCAGCTTATTTCTGGACAAGATTTAACTGGAATTGATATATCAGCCTATCATAGGCCAAGTCCACCACCAGGGACCGGCTACCACCGATACCAGTTCTACCTCTATGAGCAGCCTATTGGGATACAGCCATACCTCCTCCCTGAGGAATCTCCCAGAAGCACCTGGGATTTCGAAGCCTTTGTTGAGCGCACCANACTAGGAAAGCCCTTGGCCACCACCCAGTTCATGGCTATGAGTCACATTTCAGTTTGCA
Full Trace Sequence: GCTCGAGGGCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCCAGGACGTGGTTCCTACTCTTGGGTATCCTGTCTCTGACCGCTCGTTTCAATACACTACAGGCTGAAGAATGTTCCATAAGGAAACTCTTCAATGGTGAGGATGAAAAATTCTGCAGTAAAGGTTTAGATATTATATATTCAGATATTGGCCTAGTGTCCTGCATCTATATCCCCAACTGCTTTGACTTTTCTTGGAGCCTCTCCAAAGTGTGGGAACATCCTTTAGTCAGATACTCCAAAGCCCAACCGGGAGTAAAATACGTCCTGATTATGGTAGATTCAGATGCACCGTCCCGATGGGACCCCAAATACAGATACTGGAGGCACTGGCTGCTTACTGATATACCGGGCTGGCAGCTTATTTCTGGACAAGATTTAACTGGAATTGATATATCAGCCTATCATAGGCCAAGTCCACCACCAGGGACCGGCTACCACCGATACCAGTTCTACCTCTATGAGCAGCCTATTGGGATACAGCCATACCTCCTCCCTGAGGAATCTCCCAGAAGCACCTGGGATTTCGAAGCCTTTGTTGAGCGCACCANACTAGGAAAGCCCTTGGCCACCACCCAGTTCATGGCTATGAGTCACATTTCAGTTTGCAACTTTCTTGTACAAAATTTGCATTATAAAAAAGCATTGCTTATCAATTTGTTGCAACCAAAAAGTTCCTATTCATCAAAATAAAATCATTATTTTTCAATCCCACCTTAAAATACAAAAAAAAAAAAACAAAATAAAAAAAGAAAAAAAAATATTTCTCTGGGCGGGCTTCTGGCCCCCGTTCCAAAAAAAAAT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCCAGGACGTGGTT

Sequences - 3ʹ (reverse) EST

Accession: JZ839919
dbEST ID: 79657621
Trimmed Sequence: CTGAATGTGACTCATAGCCATGAACTGGGTGGTGGCCAAGGGCTTTCCTAGTTTGGTGCGCTCAACAAAGGCTTCGAAATCCCAGGTGCTTCTGGGAGATTCCTCAGGGAGGAGGTATGGCTGTATCCCAATAGGCTGCTCATAGAGGTAGAACTGGTATCGGTGGTAGCCGGTCCCTGGTGGTGGACTTGGCCTATGATAGGCTGATATATCAATTCCAGTTAAATCTTGTCCAGAAATAAGCTGCCAGCCCGGTATATCAGTAAGCAGCCAGTGCCTCCAGTATCTGTATTTGGGGTCCCATCGGGACGGTGCATCTGAATCTACCATAATCAGGACGTATTTTACTCCCGGTTGGGCTTTGGAGTATCTGACTAAAGGATGTTCCCACACTTTGGAGAGGCTCCNAGAAAAGTCAAAGCAGTTGGGGATATAGATGCAGGACACTAGGCCAATATCTGAATATATAATATCTAAACCTTTACTGCAAAATTTTTCATCCTCACCATTGAAAGAGTTTCCTTATGGAACATTCTTCAGCCTGTAGTGTATTGAAACCAGCGGTCAAAGACAGGATACCCCGGAATAGGAACCACGTCCTGGCCATGGTGCCCACTTTTTTTGTACAAATTTTGCAATATTAAAAAACATTGCTCAACAATTTGTTGCCACCCAAAAGGTCAAATACAAATAAAAAAAAAATAATAAATTGGGGGCCCCAACTTTAAAACGGCCCTCTTACCCCAACAAACACCCCCGGCC
Full Trace Sequence: GAAAACGGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACTGAATGTGACTCATAGCCATGAACTGGGTGGTGGCCAAGGGCTTTCCTAGTTTGGTGCGCTCAACAAAGGCTTCGAAATCCCAGGTGCTTCTGGGAGATTCCTCAGGGAGGAGGTATGGCTGTATCCCAATAGGCTGCTCATAGAGGTAGAACTGGTATCGGTGGTAGCCGGTCCCTGGTGGTGGACTTGGCCTATGATAGGCTGATATATCAATTCCAGTTAAATCTTGTCCAGAAATAAGCTGCCAGCCCGGTATATCAGTAAGCAGCCAGTGCCTCCAGTATCTGTATTTGGGGTCCCATCGGGACGGTGCATCTGAATCTACCATAATCAGGACGTATTTTACTCCCGGTTGGGCTTTGGAGTATCTGACTAAAGGATGTTCCCACACTTTGGAGAGGCTCCNAGAAAAGTCAAAGCAGTTGGGGATATAGATGCAGGACACTAGGCCAATATCTGAATATATAATATCTAAACCTTTACTGCAAAATTTTTCATCCTCACCATTGAAAGAGTTTCCTTATGGAACATTCTTCAGCCTGTAGTGTATTGAAACCAGCGGTCAAAGACAGGATACCCCGGAATAGGAACCACGTCCTGGCCATGGTGCCCACTTTTTTTGTACAAATTTTGCAATATTAAAAAACATTGCTCAACAATTTGTTGCCACCCAAAAGGTCAAATACAAATAAAAAAAAAATAATAAATTGGGGGCCCCAACTTTAAAACGGCCCTCTTACCCCAACAAACACCCCCGGCC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACTGAATGTGACTCATAGCC