ORFeome > pemt ORF1 – XORFeome v1.0

pemt ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: pemt
Gene ID: 6078073
Gene Page ID: 953359
ORF Xenbase ID: 17288751

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC078570
Original XGC clone length: 612

Human orthology & disease relationships

NCBI Entrez ID: 10400
Ensembl gene IDs: ENSG00000133027
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 211980,607785,608594

Library Location

Plate ID: GDExl11004
Well Location: B02

Sequences - 5ʹ (forward) EST

Accession: JZ839616
dbEST ID: 79657318
Trimmed Sequence: ATGGCAGACGTGCTGCAGTACGTGGTGCTGACGGACTTCCATTTTCTTGTTGCTTTGCTCTGTATAGTCTTCAATCCTTTGTTCTGGAATGTGGTTGCAAGATGGGAGTACCGGACTCACACCATCACTAGGCTGTTTGGGTCTCCGTACATTGGGTGCTACAGTTTGGGTGTAGTCATTATTTTCCTTGCCGTCCTACGGAGTCACTGTTTTACAGAAGCCATGAAGAATCAGTCCCATCTAGGGGCGCTGGAGAACACTGGCGTTTATTACCTGAGCTGGATGTTGATTGGCGCAGGCGGAGTGCTGGTGGTTTCCAGTTTCCTGGCACTGGGTTTTGTCGGAACCTATTTGGGAGACTACTTTGGGATTTTAATGGAAAAGAAGGTGACCGGCTTCCCTTTTAACATCATGGAAAATCCGATGTACTGGGGCAGCACTGCCAACTACCTGGGACTGGCCCTCTTGAACTCCAGTCCCGCCGGCCTCGTCCTCACAGCGGTGGTGGCTCTGTGCTACAAGGTGGCCATTTTGTATGAGGGGCCTTTTACAGTGGAAATCTACCGCAAGAAAGATTCTGCAAAAAAGAAAAAACCAGGGAAACTGCAATTGGCCAC
Full Trace Sequence: TCGAGGGCCCAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCAGACGTGCTGCAGTACGTGGTGCTGACGGACTTCCATTTTCTTGTTGCTTTGCTCTGTATAGTCTTCAATCCTTTGTTCTGGAATGTGGTTGCAAGATGGGAGTACCGGACTCACACCATCACTAGGCTGTTTGGGTCTCCGTACATTGGGTGCTACAGTTTGGGTGTAGTCATTATTTTCCTTGCCGTCCTACGGAGTCACTGTTTTACAGAAGCCATGAAGAATCAGTCCCATCTAGGGGCGCTGGAGAACACTGGCGTTTATTACCTGAGCTGGATGTTGATTGGCGCAGGCGGAGTGCTGGTGGTTTCCAGTTTCCTGGCACTGGGTTTTGTCGGAACCTATTTGGGAGACTACTTTGGGATTTTAATGGAAAAGAAGGTGACCGGCTTCCCTTTTAACATCATGGAAAATCCGATGTACTGGGGCAGCACTGCCAACTACCTGGGACTGGCCCTCTTGAACTCCAGTCCCGCCGGCCTCGTCCTCACAGCGGTGGTGGCTCTGTGCTACAAGGTGGCCATTTTGTATGAGGGGCCTTTTACAGTGGAAATCTACCGCAAGAAAGATTCTGCAAAAAAGAAAAAACCAGGGAAACTGCAATTGGCCACTTTCTTTGTCAAAGTTGGGCATTATAAGAAAGCATTTGTTTATCATTTGTTGCAACGAAACGGGTCACTATCAATCAAAATAAAATCTTTATTTTGGCATCCACCTAAATCCCCTATAGTGAATCCGAATACTTGGGCAAAACATGATTCCGAGAAACATTAGGACCGGGTCCAAAAAATTCCCCGTAAAGTATAAAAAAAAAGACCAAGGGGAGTATTAG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCAGACGTGCTGCAGTA

Sequences - 3ʹ (reverse) EST

Accession: JZ839615
dbEST ID: 79657317
Trimmed Sequence: TTGCAGTTTCCCTGGTTTTTTCTTCTTTGCAGAATCTTTCTTGCGGTAGATTTCCACTGTAAAAGGCCCCTCATACAAAATGGCCACCTTGTAGCACAGAGCCACCACCGCTGTGAGGACGAGGCCGGCGGGACTGGAGTTCAAGAGGGCCAGTCCCAGGTAGTTGGCAGTGCTGCCCCAGTACATCGGATTTTCCATGATGTTAAAAGGGAAGCCGGTCACCTTCTTTTCCATTAAAATCCCAAAGTAGTCTCCCAAATAGGTTCCGACAAAACCCAGTGCCAGGAAACTGGAAACCACCAGCACTCCGCCTGCGCCAATCAACATCCAGCTCAGGTAATAAACGCCAGTGTTCTCCAGCGCCCCTAGATGGGACTGATTCTTCATGGCTTCTGTAAAACAGTGACTCCGTAGGACGGCAAGGAAAATAATGACTACACCCAAACTGTAGCACCCAATGTACGGAGACCCAAACAGCCTAGTGATGGTGTGAGTCCGGTACTCCCATCTTGCAACCCCCTTCCAGAACAAAGGATTGAAGACTATACAGAGCAAAGCAACAAGAAAATGGAAGTCCGTCAGCACCACGTACTGCAGCACGTCTGGCATGGTGCCGACTTTTTTTGTCCAAAGTTGGCATTTAAAAAAAGCATTGCCTCCACCATTTTTTTGCAACAAACAGGTTCACTATCGTCCAAAATAAAATTAATAATTTTGAGGGCCAGAAGATAAAAGAAAAAGAACATACAATAGAAAAAACGACCAAGGGTGTGCC
Full Trace Sequence: AAGCAGGCTAATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTGCAGTTTCCCTGGTTTTTTCTTCTTTGCAGAATCTTTCTTGCGGTAGATTTCCACTGTAAAAGGCCCCTCATACAAAATGGCCACCTTGTAGCACAGAGCCACCACCGCTGTGAGGACGAGGCCGGCGGGACTGGAGTTCAAGAGGGCCAGTCCCAGGTAGTTGGCAGTGCTGCCCCAGTACATCGGATTTTCCATGATGTTAAAAGGGAAGCCGGTCACCTTCTTTTCCATTAAAATCCCAAAGTAGTCTCCCAAATAGGTTCCGACAAAACCCAGTGCCAGGAAACTGGAAACCACCAGCACTCCGCCTGCGCCAATCAACATCCAGCTCAGGTAATAAACGCCAGTGTTCTCCAGCGCCCCTAGATGGGACTGATTCTTCATGGCTTCTGTAAAACAGTGACTCCGTAGGACGGCAAGGAAAATAATGACTACACCCAAACTGTAGCACCCAATGTACGGAGACCCAAACAGCCTAGTGATGGTGTGAGTCCGGTACTCCCATCTTGCAACCCCCTTCCAGAACAAAGGATTGAAGACTATACAGAGCAAAGCAACAAGAAAATGGAAGTCCGTCAGCACCACGTACTGCAGCACGTCTGGCATGGTGCCGACTTTTTTTGTCCAAAGTTGGCATTTAAAAAAAGCATTGCCTCCACCATTTTTTTGCAACAAACAGGTTCACTATCGTCCAAAATAAAATTAATAATTTTGAGGGCCAGAAGATAAAAGAAAAAGAACATACAATAGAAAAAACGACCAAGGGTGTGCC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTGCAGTTTCCCTGGTTTTTTCTT