ORFeome > pex11b ORF1 – XORFeome v1.0

pex11b ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: pex11b
Gene ID: 5910292
Gene Page ID: 5910253
ORF Xenbase ID: 17288787

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC059330
Original XGC clone length: 741

Human orthology & disease relationships

NCBI Entrez ID: 8799
Ensembl gene IDs: ENSG00000131779
Directly associated (OMIM) disease MIM numbers: 614920
Indirectly associated (Lage, et al.) disease MIM numbers: 214100,300100,300475

Library Location

Plate ID: GDExl11020
Well Location: B03

Sequences - 5ʹ (forward) EST

Accession: JZ824629
dbEST ID: 79642331
Trimmed Sequence: ATGGACTCGTGGGTTCGGTTCAGCGGCCAGAGCCAGGCCAAGGAGCGAGTCATCAGAGCGGCGCAGTACGCATGCACATTAATCGGATACACGCTGCAGAAGAACGGCGGCAGCGCAGAACTCATCTCCGGCCTCAAGCAGTTGGAAAGTCACCTGAGTTTGGGGCGCAAGTTGTTTCGCTTGGGGAACTCGGTGGAGGCGCTGGAGTCGGCGAAACGCGCAATCCATCTGTCCGACCTGGTCCTTCGCTTCTGCATAACGGTCAGTCACCTCAACCGGGCCATGTACTTTGCCTGCGACAACATTCTGTGGGTCGGGAAATGCGGCCTCTCTCCTAAGGTCGACCAGAACAAGTGGAGCGAACGCTCATTCAGGTATTACCTCTTCTCGCTGCTCATGAACCTCACCAGGGACCTGTATGAGATCAAACTCCTGATGGAGGCAGAGACCAGCGGGAAGCATCTGTCTGACAAACTGAGTGAGGATAATGGTGTCGTCTCTCGTGGTTCCTCCTCCTCCCGCCACCCCATAGCCCTCCAGATCCGCCTGCTGATCCACATCTTCCGGAGCAACCCCCCTCTCCTCTTGGACCTGCTNCAGAATTCCTGTGACCTCTTCATTCCACTGGACAAGCTGGGACTGTACAAGACTAACCCTGGCTTTGTGGGTTTATGCGGCCTGACCCTCCTCATATTGTCCATCCTCACCTTCCTCCACCCTTGGCTGAAGCTCAAGCCCTTGCCCAACTCTCTTGTATCAAGTGGGCATTATAAAAAAGCAATGGCCTTATCCATTTGGGTGGCACCGAAAAGGGGTCCCTATCAGTCCAAAAAAGAA
Full Trace Sequence: CATTATTGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGACTCGTGGGTTCGGTTCAGCGGCCAGAGCCAGGCCAAGGAGCGAGTCATCAGAGCGGCGCAGTACGCATGCACATTAATCGGATACACGCTGCAGAAGAACGGCGGCAGCGCAGAACTCATCTCCGGCCTCAAGCAGTTGGAAAGTCACCTGAGTTTGGGGCGCAAGTTGTTTCGCTTGGGGAACTCGGTGGAGGCGCTGGAGTCGGCGAAACGCGCAATCCATCTGTCCGACCTGGTCCTTCGCTTCTGCATAACGGTCAGTCACCTCAACCGGGCCATGTACTTTGCCTGCGACAACATTCTGTGGGTCGGGAAATGCGGCCTCTCTCCTAAGGTCGACCAGAACAAGTGGAGCGAACGCTCATTCAGGTATTACCTCTTCTCGCTGCTCATGAACCTCACCAGGGACCTGTATGAGATCAAACTCCTGATGGAGGCAGAGACCAGCGGGAAGCATCTGTCTGACAAACTGAGTGAGGATAATGGTGTCGTCTCTCGTGGTTCCTCCTCCTCCCGCCACCCCATAGCCCTCCAGATCCGCCTGCTGATCCACATCTTCCGGAGCAACCCCCCTCTCCTCTTGGACCTGCTNCAGAATTCCTGTGACCTCTTCATTCCACTGGACAAGCTGGGACTGTACAAGACTAACCCTGGCTTTGTGGGTTTATGCGGCCTGACCCTCCTCATATTGTCCATCCTCACCTTCCTCCACCCTTGGCTGAAGCTCAAGCCCTTGCCCAACTCTCTTGTATCAAGTGGGCATTATAAAAAAGCAATGGCCTTATCCATTTGGGTGGCACCGAAAAGGGGTCCCTATCAGTCCAAAAAAGAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGACTCGTGGGTTCGGTT

Sequences - 3ʹ (reverse) EST

Accession: JZ829979
dbEST ID: 79647681
Trimmed Sequence: GGGCTTGAGCTTCAGCCAAGGGTGGAGGAGGGTGAGGATGGACAATATGGAGGAGGTCAGGCCGCATAAACCCACAAAGCCAGGGTTAGTCTTGTACAGTCCCAGCTTGTCCAGTGGAATGAAGAGGTCACAGGAATTCTTGAGCAGGTCCAAGAGGAGAGGGGGGTTGCTCCGGAAGATGTGGATCAGCAGGCGGATCTGGAGGGCTATGGGGTGGCGGGAGGAGGAGGAACCACGAGAGACGACACCATTATCCTCACTCAGTTTGTCAGACAGATGCTTCCCGCTGGTCTCTGCCTCCATCAGGAGTTTGATCTCATACAGGTCCCTGGTGAGGTTCATGAGCAGCGAGAAGAGGTAATACCTGAATGAGCGTTCGCTCCACTTGTTCTGGTCGACCTTAGGAGAGAGGCCGCATTTCCCGACCCACAGAATGTTGTCGCAGGCAAAGTACATGGCCCGGTTGAGGTGACTGACCGTTATGCAGAAGCGAAGGACCAGGTCGGACAGATGGATTGCGCGTTTCGCCGACTCCAGCGCCTCCACCGAGTTCCCCAAGCCAAACAACTTGCGCCCCAGACTCAGGTGACTTTTCCACTGCTTGAGGCCGGAAATGGATTCTGCGCTGCCGCCGTTCTTCCTGCAGCCTGTATCCCAATTAATGTGCATGCCGTACTGCGCCCGCTCTTGATGACTCGGCTTTTTTGGGCCTGGCTTCCTGGGCCGCTGAAACCCGAAACCCACCAAGTTCCAAGTGGGG
Full Trace Sequence: CAGGGAATATGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGGGCTTGAGCTTCAGCCAAGGGTGGAGGAGGGTGAGGATGGACAATATGGAGGAGGTCAGGCCGCATAAACCCACAAAGCCAGGGTTAGTCTTGTACAGTCCCAGCTTGTCCAGTGGAATGAAGAGGTCACAGGAATTCTTGAGCAGGTCCAAGAGGAGAGGGGGGTTGCTCCGGAAGATGTGGATCAGCAGGCGGATCTGGAGGGCTATGGGGTGGCGGGAGGAGGAGGAACCACGAGAGACGACACCATTATCCTCACTCAGTTTGTCAGACAGATGCTTCCCGCTGGTCTCTGCCTCCATCAGGAGTTTGATCTCATACAGGTCCCTGGTGAGGTTCATGAGCAGCGAGAAGAGGTAATACCTGAATGAGCGTTCGCTCCACTTGTTCTGGTCGACCTTAGGAGAGAGGCCGCATTTCCCGACCCACAGAATGTTGTCGCAGGCAAAGTACATGGCCCGGTTGAGGTGACTGACCGTTATGCAGAAGCGAAGGACCAGGTCGGACAGATGGATTGCGCGTTTCGCCGACTCCAGCGCCTCCACCGAGTTCCCCAAGCCAAACAACTTGCGCCCCAGACTCAGGTGACTTTTCCACTGCTTGAGGCCGGAAATGGATTCTGCGCTGCCGCCGTTCTTCCTGCAGCCTGTATCCCAATTAATGTGCATGCCGTACTGCGCCCGCTCTTGATGACTCGGCTTTTTTGGGCCTGGCTTCCTGGGCCGCTGAAACCCGAAACCCACCAAGTTCCAAGTGGGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGGGCTTGAGCTTCAGCCA