ORFeome > pex19 ORF1 – XORFeome v1.0

pex19 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: pex19
Gene ID: 973481
Gene Page ID: 973477
ORF Xenbase ID: 17288817

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC123295
Original XGC clone length: 861

Human orthology & disease relationships

NCBI Entrez ID: 5824
Ensembl gene IDs: ENSG00000162735
Directly associated (OMIM) disease MIM numbers: 614886
Indirectly associated (Lage, et al.) disease MIM numbers: 131760,131800,131900,131960,179850,202370,214100,278300,300100,300475,609040,609352

Library Location

Plate ID: GDExl11083
Well Location: B09

Sequences - 5ʹ (forward) EST

Accession: JZ837390
dbEST ID: 79655092
Trimmed Sequence: ATGGCTGGGGCCGGGGAAGAGGACAAGGAACTGGATGAACTGCTGGACAGTGCCCTCGATGATTTTGACAAGACTAACCAACCTCCCCCAGTCCCCAGCCACAGCTACAAAAGCTTCTGGGCCTGAGAAACCTCCTGGAGATGCTGCCAAGGACCCTCTCTTCACATCCCAAGAACAGTTCTTCCAAGAGTTGTTCAGCACTGAGCTGGCAGCCCAGGCCACACAGGAGTTTGAGAAGGCCATGAAGGAGCTGGCTGAGGAGGAGCCACACCTGGTGGAACAGTTCCAGAAACTCTCAGAGGCTGCAGGGAAAGTTGGAAGTGATGAAACCTCACAGCAAGAGTTTACTTCCTGTCTGAAAGAGACTCTCTCGGGTCTAGCCAAGAATGCAGATGATTTGCAGAGCTCCAGCTTGTCGGAGGAAGAGTTGGCCAAGGCGATGGAGGGTTTGGGCGTGGACGAAACAGACGGGGATGGGAACATCCTGCCTCTCATGCAGAACATTATGCAGAATCTCCTCTCCNAGGAAGTTTTGTATCCATCCCTCAAAGAGATCACAGAAAAGTACCCAGACTGGCTGAGGAGTCACCGGGACTCCCTACCAACTGAGGAATACAACAAATAACAGGAACAGCCTCAACTCATGGGGGAGATTTGCCCGCAGTTTTGAATCGGAACCGTCCGGCCACATTAAAGCAGCCCGGGTTCCAGGGCGGTGATGGAACCTCAATCCACCCCCTTCAGAAACTAAGGGCCACCCCCCCTAAAGAAACCTGGGCGGGAAAATTCCCCCCCCCGGCCCTAAAACTTTTTTCCC
Full Trace Sequence: CGAGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCTGGGGCCGGGGAAGAGGACAAGGAACTGGATGAACTGCTGGACAGTGCCCTCGATGATTTTGACAAGACTAACCAACCTCCCCCAGTCCCCAGCCACAGCTACAAAAGCTTCTGGGCCTGAGAAACCTCCTGGAGATGCTGCCAAGGACCCTCTCTTCACATCCCAAGAACAGTTCTTCCAAGAGTTGTTCAGCACTGAGCTGGCAGCCCAGGCCACACAGGAGTTTGAGAAGGCCATGAAGGAGCTGGCTGAGGAGGAGCCACACCTGGTGGAACAGTTCCAGAAACTCTCAGAGGCTGCAGGGAAAGTTGGAAGTGATGAAACCTCACAGCAAGAGTTTACTTCCTGTCTGAAAGAGACTCTCTCGGGTCTAGCCAAGAATGCAGATGATTTGCAGAGCTCCAGCTTGTCGGAGGAAGAGTTGGCCAAGGCGATGGAGGGTTTGGGCGTGGACGAAACAGACGGGGATGGGAACATCCTGCCTCTCATGCAGAACATTATGCAGAATCTCCTCTCCNAGGAAGTTTTGTATCCATCCCTCAAAGAGATCACAGAAAAGTACCCAGACTGGCTGAGGAGTCACCGGGACTCCCTACCAACTGAGGAATACAACAAATAACAGGAACAGCCTCAACTCATGGGGGAGATTTGCCCGCAGTTTTGAATCGGAACCGTCCGGCCACATTAAAGCAGCCCGGGTTCCAGGGCGGTGATGGAACCTCAATCCACCCCCTTCAGAAACTAAGGGCCACCCCCCCTAAAGAAACCTGGGCGGGAAAATTCCCCCCCCCGGCCCTAAAACTTTTTTCCC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCTGGGGCCGGGGA

Sequences - 3ʹ (reverse) EST

Accession: JZ837389
dbEST ID: 79655091
Trimmed Sequence: CATGATCAGGCACTGTTCCCCATTGGCGCTTCCTGAACCGGCCAAATTTACTCCATCAAGGTCAAAGTTCATGCCTGGAGGAGAATCTCCTGCCAGTTCCTTAGGTGGGTGCCCTAGTTCTTGAAGCTGTTGCATCAGATCCATCACAGCCTCGAACCGCGCTGCCTCACTGTTGCCAGACTGCTCCGACTCAAACTGCTGGCAAATCTTCCCCATGAGCTTGTGCTGCTCCTTGTATTTGTTGTATTCCTCAGCTGGTAGGGAGTCCCGGTGACTCCTCAGCCAGTCTGGGTACTTTTCTGTGATCTCTTTGAGGGATGGATACAAAACTTCCTTGGAGAGGAGATTCTGCATAATGTTCTGCATGAGAGGCAGGATGTTCCCATCCCCGTCTGTTTCGTCCACGCCCAAACCCTCCATCGCCTTGGCCAACTCTTCCTCCAACAAGCTAGAGCTCTGCAAATCATCTGCATTCTTGTCTAGACGCAAGAAAGTCTCTTTCAGACAGGAGGTAAACTCTTGCTGTGAGGGTTCAGCGGCTCCCACTTTCCCTGCACCCTCTAACAATTTCAAGAACATATTCACCCGGTCTGGGCTCGGGGGCACTCACCCCCTTCCTGGGCTTCTCGGGGCTCTTCTGTGACCTTGGGCGGCGGCCGCGGTGGCTGACAGGCGCTGAAAAAACCTGTTGCGTAAAAAATTAAAAAAAGGAATCCATAGGAAGGAGGGGCGGGGGGAGAGTTGGCGGGGGGGGGGGAGAGCCTTTGTGG
Full Trace Sequence: GGGAAAATGCTATGGACCATGTAATACGACTCACTATAGGGGGAATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACATGATCAGGCACTGTTCCCCATTGGCGCTTCCTGAACCGGCCAAATTTACTCCATCAAGGTCAAAGTTCATGCCTGGAGGAGAATCTCCTGCCAGTTCCTTAGGTGGGTGCCCTAGTTCTTGAAGCTGTTGCATCAGATCCATCACAGCCTCGAACCGCGCTGCCTCACTGTTGCCAGACTGCTCCGACTCAAACTGCTGGCAAATCTTCCCCATGAGCTTGTGCTGCTCCTTGTATTTGTTGTATTCCTCAGCTGGTAGGGAGTCCCGGTGACTCCTCAGCCAGTCTGGGTACTTTTCTGTGATCTCTTTGAGGGATGGATACAAAACTTCCTTGGAGAGGAGATTCTGCATAATGTTCTGCATGAGAGGCAGGATGTTCCCATCCCCGTCTGTTTCGTCCACGCCCAAACCCTCCATCGCCTTGGCCAACTCTTCCTCCAACAAGCTAGAGCTCTGCAAATCATCTGCATTCTTGTCTAGACGCAAGAAAGTCTCTTTCAGACAGGAGGTAAACTCTTGCTGTGAGGGTTCAGCGGCTCCCACTTTCCCTGCACCCTCTAACAATTTCAAGAACATATTCACCCGGTCTGGGCTCGGGGGCACTCACCCCCTTCCTGGGCTTCTCGGGGCTCTTCTGTGACCTTGGGCGGCGGCCGCGGTGGCTGACAGGCGCTGAAAAAACCTGTTGCGTAAAAAATTAAAAAAAGGAATCCATAGGAAGGAGGGGCGGGGGGAGAGTTGGCGGGGGGGGGGGAGAGCCTTTGTGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACATGATCAGGCACTGTTCCCCATT