ORFeome > pfdn6 ORF2 – XORFeome v1.0

pfdn6 ORF2 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: pfdn6
Gene ID: 6252463
Gene Page ID: 489364
ORF Xenbase ID: 17288835

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC123375
Original XGC clone length: 381

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11084
Well Location: D05

Sequences - 5ʹ (forward) EST

Accession: JZ837528
dbEST ID: 79655230
Trimmed Sequence: ATGGCGGAACAATTACAAGAGAAGTTACAGTCCGAGATTTCCAAATACCAGCAGCTCCAGAAAGAGATCAGCACTAGTATGTCAGCCAGGCAAAAGCTTGAGGCTCAGTTGACTGAAAATAACATTGTGAAACAGGAGCTGGCTCTCCTGGATGACAGTAACACTGTATATAAACTAATTGGTCCAGTGCTGGTGAAGCAGGACCTGGAAGAGGCAAAGTCTACTGTGGATAAAAGGCTGCAGTACATTAATGGAGAAATCAAAAGATATGAGACCACACTTAAGGATATGGAGCAGCGTTCAGAGCAACATAGAGGGACCCTTAGCAAGCTTCAACAAGATTACCAGAGAGCACAAGGAAAGGGGCCAGTGAAGGCCTT
Full Trace Sequence: CTCGAGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCGGAACAATTACAAGAGAAGTTACAGTCCGAGATTTCCAAATACCAGCAGCTCCAGAAAGAGATCAGCACTAGTATGTCAGCCAGGCAAAAGCTTGAGGCTCAGTTGACTGAAAATAACATTGTGAAACAGGAGCTGGCTCTCCTGGATGACAGTAACACTGTATATAAACTAATTGGTCCAGTGCTGGTGAAGCAGGACCTGGAAGAGGCAAAGTCTACTGTGGATAAAAGGCTGCAGTACATTAATGGAGAAATCAAAAGATATGAGACCACACTTAAGGATATGGAGCAGCGTTCAGAGCAACATAGAGGGACCCTTAGCAAGCTTCAACAAGATTACCAGAGAGCACAAGGAAAGGGGCCAGTGAAGGCCTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGCTCTGAAAAGTGTAAAAAAACAAGAATGTTACAGGCCCCGCTGGGGGAGCGGGGGGGGATGGGACAAAAAAAAAAACTAACAAAAGAAGGGGGGGGAGCTCCTCTTCGGATTTGGTGAGGGGGGAGGCCGGGAACTAGACCAGTTCGGGTGGTAGGCATGGAAGGGGGGGGGGAGGGGCCCCCGGAGAGGGGGCAAAAAGTGGAGAGAACCCCCCCGGGGGGGAGGGGAGGCAGGGGGGGGGGTTTTGGGGTTTGTGGAAAAAAAGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGGAACAATTACAAGAGA

Sequences - 3ʹ (reverse) EST

Accession: JZ837527
dbEST ID: 79655229
Trimmed Sequence: GGCCTTCACTGGCCCCTTTCCTTGTGCTCTCTGGTAATCTTGTTGAAGCTTGCTAAGGGTCCCTCTATGTTGCTCTGAACGCTGCTCCATATCCTTAAGTGTGGTCTCATATCTTTTGATTTCTCCATTAATGTACTGCAGCCTTTTATCCACAGTAGACTTTGCCTCTTCCAGGTCCTGCTTCACCAGCACTGGACCAATTATTTTATATACAGTGTTACTGTCATCCAGGAGAGCCAGCTCCTGTTTCACAATGTTATTTTCAGTCAACTGAGCCTCAAGCTTTTGCCTGGCTGACATACTANTGCTGATCTCTTTCTGGAGCTGCTGGTATTTGGAAATCTCGGACTGTAACTTCTCTTGTAATTGTTCCGCCATGG
Full Trace Sequence: GGAAACATGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCNTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGGCCTTCACTGGCCCCTTTCCTTGTGCTCTCTGGTAATCTTGTTGAAGCTTGCTAAGGGTCCCTCTATGTTGCTCTGAACGCTGCTCCATATCCTTAAGTGTGGTCTCATATCTTTTGATTTCTCCATTAATGTACTGCAGCCTTTTATCCACAGTAGACTTTGCCTCTTCCAGGTCCTGCTTCACCAGCACTGGACCAATTATTTTATATACAGTGTTACTGTCATCCAGGAGAGCCAGCTCCTGTTTCACAATGTTATTTTCAGTCAACTGAGCCTCAAGCTTTTGCCTGGCTGACATACTANTGCTGATCTCTTTCTGGAGCTGCTGGTATTTGGAAATCTCGGACTGTAACTTCTCTTGTAATTGTTCCGCCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGGGGCCCGAGAAAAGGAAAAAAAAACAATTATAAACTTCGGCTTTATAAAGGGACTGGGCGGGAATGACTAAACTAACTGGCAAAAAAGAGAAGGAGAGAATCTTCTTTTGGATCGTGTAGGGGGAGAACCCCGGGGAAAAGACCTCCCCTTTAATAAAATAAAAAGATTTGGTATGCGCCACACCGGGGGCCCAATTCTTACAAAGAGGGGGTGGGAAGGACCGAAGAGCGGTTTTTTGTGTTTGTTATTNGTTTTTTGTGGGGGGAGAGAAAANATAAACAAAGGGAGAGGAGGGC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGGCCTTCACTGGCCCCT