ORFeome > pgam2 ORF1 – XORFeome v1.0

pgam2 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: pgam2
Gene ID: 6254944
Gene Page ID: 971121
ORF Xenbase ID: 17288877

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC054230
Original XGC clone length: 762

Human orthology & disease relationships

NCBI Entrez ID: 5224
Ensembl gene IDs: ENSG00000164708
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 102900,266150,266200,313400

Library Location

Plate ID: GDExl11002
Well Location: G02

Sequences - 5ʹ (forward) EST

Accession: JZ839246
dbEST ID: 79656948
Trimmed Sequence: ATGCCTCACCGCCTAGTAATCGTACGCCACGGAGAAAGCTCGTGGAATCAGGAGAACAGGTTCTGTGGCTGGTTTGATGCCGACCTGAGTGAGAAAGGGGCAGAGGAGGCCCGTAGAGGAGCTCAGGCAATAAAGGAGGCCGGGATGGAGTTTGACATCTGCTACACCTCCGTGCTGAAGAGAGCGGTGCGTACTCTGTGGTACATCTTGGACGGAGTAGACCAAATGTGGCTGCCAGTGGTCAGGACCTGGAGACTGAATGAGCGCCACTATGGGGGACTGACAGGCCTCAACAAGGCAGAGACTGCGGAGAAACATGGGGAAGAGCAGGTGAAGATATGGAGACGATCTTATGACACCCCACCACCAGTCATGGGAGAAGATCACCCATACTACAAGCTGATAAGTAAGGATCGGCGTTACAAAGATCTCACCTCTACAGAGCTGCCCTCCTGTGAGAGTCTGAAGGACACCATTGCCCGTGCCCTACCCTTTTGGAATGAAGTGATTGCCCCCCAGATCCTGGCTGGAAAGCGAGTACTGATCGCAGCACATGGAAACAGCTGGAGAGGCATTGTAAAGCACCTGGATGGGATGTCTGATGCTGCCATCATGGGACTTAGTCTACCCACTGGAATTCCCATTGTATATTAACTTGATGATAACCTGAAGCCAACCCAACCCATTAACCTCCCTTGGGGATTAAGAAACTTGACCGAAAAGCCATGGAGGCCAGTGGCAGCCCCGGGAAAAGGCCCAAAAAAATTGGCACACTTTTCTTGTGACAAGGTTTTGGCTATT
Full Trace Sequence: GCTCGGGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCCTCACCGCCTAGTAATCGTACGCCACGGAGAAAGCTCGTGGAATCAGGAGAACAGGTTCTGTGGCTGGTTTGATGCCGACCTGAGTGAGAAAGGGGCAGAGGAGGCCCGTAGAGGAGCTCAGGCAATAAAGGAGGCCGGGATGGAGTTTGACATCTGCTACACCTCCGTGCTGAAGAGAGCGGTGCGTACTCTGTGGTACATCTTGGACGGAGTAGACCAAATGTGGCTGCCAGTGGTCAGGACCTGGAGACTGAATGAGCGCCACTATGGGGGACTGACAGGCCTCAACAAGGCAGAGACTGCGGAGAAACATGGGGAAGAGCAGGTGAAGATATGGAGACGATCTTATGACACCCCACCACCAGTCATGGGAGAAGATCACCCATACTACAAGCTGATAAGTAAGGATCGGCGTTACAAAGATCTCACCTCTACAGAGCTGCCCTCCTGTGAGAGTCTGAAGGACACCATTGCCCGTGCCCTACCCTTTTGGAATGAAGTGATTGCCCCCCAGATCCTGGCTGGAAAGCGAGTACTGATCGCAGCACATGGAAACAGCTGGAGAGGCATTGTAAAGCACCTGGATGGGATGTCTGATGCTGCCATCATGGGACTTAGTCTACCCACTGGAATTCCCATTGTATATTAACTTGATGATAACCTGAAGCCAACCCAACCCATTAACCTCCCTTGGGGATTAAGAAACTTGACCGAAAAGCCATGGAGGCCAGTGGCAGCCCCGGGAAAAGGCCCAAAAAAATTGGCACACTTTTCTTGTGACAAGGTTTTGGCTATT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCCTCACCGCCTAGTAA

Sequences - 3ʹ (reverse) EST

Accession: JZ839245
dbEST ID: 79656947
Trimmed Sequence: TTTTTTGGCCTTTCCCTGGGCTGCCACTGCCTCCATGGCTTTCCGTACAGTTTCCTCATCCCCAAGGAAGCTCATGGGTTTGGTTGGCTTCAGGTTATCATCAAGTTCATATACAATGGGAATTCCAGTGGGTAGATTAAGTTCCATGATGGCAGCATCAGACATCCCATCCAGGTGCTTTACAATGCCTCTCAAGCTGTTTCCATGTGCTGCGATCAGTACTCGCTTTCCAGCCAGGATCTGGGGGGCAATCACTTCATTCCAAAAGGGTAGGGCACGGGCAATGGTGTCCTTCAGACTCTCACAGGAGGGCAGCTCTGTAGAGGTGAGATCTTTGTAACGCCGATCCTTACTTATCAGCTTGTAGTATGGGTGATCTTCTCCCATGACTGGTGGTGGGGTGTCATAAGATCGTCTCCATATCTTCACCTGCTCTTCCCCATGTTTCTCCGCAGTCTCTGCCTTGTTGAGGCCTGTCAGTCCCCCATAGTGGCGCTCATTCAGTCTCCAGGTCCTGACCACTGGGCACCACATTTGGTCTACTCCGTCCCAGATGTACCACAAAAGTACGCACCGCTCTCTTCAGCACGGAGGGTGTACAAATGTTCAACTCCATCCCCGCCCTCCTTTATGCCCGAAACTCCCTCCTCGGGGCCCCCTCCTCCCCTTTTCCCCCTTCAAGTTGGGCATTAAAACCCAGCCCCCAAAAACTGGTTTTCCCTGGAATTTCCCAGAAAACTTTTCTTCCCCTTGGCCGTAAGAAAATAAAC
Full Trace Sequence: GGCAGGGAACAGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCNTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTTTTTGGCCTTTCCCTGGGCTGCCACTGCCTCCATGGCTTTCCGTACAGTTTCCTCATCCCCAAGGAAGCTCATGGGTTTGGTTGGCTTCAGGTTATCATCAAGTTCATATACAATGGGAATTCCAGTGGGTAGATTAAGTTCCATGATGGCAGCATCAGACATCCCATCCAGGTGCTTTACAATGCCTCTCAAGCTGTTTCCATGTGCTGCGATCAGTACTCGCTTTCCAGCCAGGATCTGGGGGGCAATCACTTCATTCCAAAAGGGTAGGGCACGGGCAATGGTGTCCTTCAGACTCTCACAGGAGGGCAGCTCTGTAGAGGTGAGATCTTTGTAACGCCGATCCTTACTTATCAGCTTGTAGTATGGGTGATCTTCTCCCATGACTGGTGGTGGGGTGTCATAAGATCGTCTCCATATCTTCACCTGCTCTTCCCCATGTTTCTCCGCAGTCTCTGCCTTGTTGAGGCCTGTCAGTCCCCCATAGTGGCGCTCATTCAGTCTCCAGGTCCTGACCACTGGGCACCACATTTGGTCTACTCCGTCCCAGATGTACCACAAAAGTACGCACCGCTCTCTTCAGCACGGAGGGTGTACAAATGTTCAACTCCATCCCCGCCCTCCTTTATGCCCGAAACTCCCTCCTCGGGGCCCCCTCCTCCCCTTTTCCCCCTTCAAGTTGGGCATTAAAACCCAGCCCCCAAAAACTGGTTTTCCCTGGAATTTCCCAGAAAACTTTTCTTCCCCTTGGCCGTAAGAAAATAAAC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTTTTTGGCCTTTCCCTGGGCT