ORFeome > pggt1b ORF1 – XORFeome v1.0

pggt1b ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: pggt1b
Gene ID: 975352
Gene Page ID: 975345
ORF Xenbase ID: 17288913

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC097794
Original XGC clone length: 1119

Human orthology & disease relationships

NCBI Entrez ID: 5229
Ensembl gene IDs: ENSG00000164219
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 109800,115150,218040,607785,609942

Library Location

Plate ID: GDExl11089
Well Location: E07

Sequences - 5ʹ (forward) EST

Accession: #N/A
dbEST ID: #N/A
Trimmed Sequence: #N/A
Full Trace Sequence: GGGGCGCCGCCACATGATAAAGATGTATTATATATATATATACGAATATATGGAGCCTGGGTTCTGCTTCCACACAAATATAGATAGAGACACAGGCGCTTTTCTTATATAGCGCGCCACCTTGTGTTTCACAAAAAATATGAGCGCGCCGGCGAGGTGCGCTGCGGGCAGAGTCTCATTCAGTGTTCTCGACCTACACTGTCTTAGAGGAAATCTCTACACTGAAATCGGTGCGAGGCTAGTACATTATCCAAACAAATCAGTTGCTCGCGATACCAAGCGTGTGTTCATTCACGGGCTAGCATTCTATGAGACTCTCGTCGCACCTATGTATCTCGTAGCGAGTATGTGTATGAGAGATGTAGTACCGCACCACTATTATATGAGACACAAGTCACGATAGCCTCCTTATTCCTGTCGCGGTTTCGAAGTCACAGCATGTGGGAACAAGCTATAGTGCTAGTGTCTTGCGTACGCAGCTAAGAGTCTACCTCGCACTATTCAATAATAGCAAATAGTACACGAACGAAGCGTTGCTTCGGTTTGCGCATTTCTTTGCAGCGGCGCTGCCTTTATGAGTGACATCACTTACACCCGCAGGCGAATAACAGTTAGCAAGCCGCCCGTGGATACGGAACATGCGTCTACAGCCATTTCTTGAGACTGGGCGCGTGCACACTTCTACTGTATTCGATTACGCCTTTGCCGCCACGCTNTGGCTAGAAAGTGAACTAATCTGTGATTAAAATCCGCTCATCTTATGAATTCTCCCTGCCGCAACTGGCCATACTTCTTTAGATGCATGCCCGGTACGAACCGGTCTATCGTGGCTCTGGCCTCTCCTCGACACGAGGAGGGGTACGTGGAGAAGCTCAGACGCACACCGACTCCATGTCACCCCTCCCCCTCCCCCCCTCATTATGAACGCCTTTTCTTGTCTGTTGCGAAAGTTTGATATGGAGTCTTTAGTTTGGCTAAGGTCACGGAAGGGCGCGGCCTCCCTCGTACTCTCTCGCCATCAAACCCGGCGCAACNCAGCGCGGCGTCCTAATATATAATACGCATATTGTATTTATGATTTTTGTGAGTACGCCTAAATTGACCTCGACATTATGCCCTCTGTGCCCACCCCGTACAGATATACCGCACCACCTAATGTCTATGTGGGCCGTGCGTCGCAGATCGAATGAAGACAGGCTGTTGTATGAATAAGTCGCCGGCAGAGTTATGTGAAGAGAAGGAACGACGATTGACGGCACCCGTTGCACCGACCCTCGCGGACCCGCTGC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGGATGATGAAGATGGT

Sequences - 3ʹ (reverse) EST

Accession: JZ838416
dbEST ID: 79656118
Trimmed Sequence: AGTTCCAATGTGCATATTATCGGAGTTCCTTTCACAGTCCTTTGATTTCCAAGAGTCGTGCAGCTGCTGGAGATGCTTATATGTTGTTAAACTTACATTCAGAGCTGGATGGACTTCACAGATGCCAGGCTCTCCTATAAGAGACAGGCCACAGATCCCAAAGTAGGCATGCAATGCATCTGGGTGGCTATCTGGCCATTTAGCAAAACCTCCAACAATGCGATCCTGGGTGGACAATATAAAATTTCTGTTTTTTTCAAAATTTGTATATTTGAAGATGTCCAACAGCATTAAAGTTGCTCCGACCCAAAAGGAATAACAAGTGTCAGCAGGTTTGTTTGGCCGTCCGTGAAAACCATTTTGTTGCCTCAATATGCACCACCTTCGCATTCTGTTCGGTTCCTTCTCTCAAAATACCTCCTCCAGTTTGCCCGTCAAGCAAAGGGAAGCAATTCCACCCAACGTATAGGCGCGCTGGGCTGCGGATCCGCCCCCGTGTCCCGGAGCGAGTTTGTATAACATACTCACTCCCATGTGATCAATCAATCCTGTGTGTATCATACCCCAACAGCTCGTGGAGCGTGGGGAGGGGGAGGAACAGGGAGGGGGAGAACTCCTTGTTGGTGTTTGTTTTTTTTTTCTCTCGGCAGCAGAGACGGTGGGCAAAGAACCTAAAAAAAAGGAGAGGACAGCCGAGGGGACCGGGGCGGGGTTGACAACAATATAAATATAGGTGGGCTATT
Full Trace Sequence: GGGAAAATGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAGTTCCAATGTGCATATTATCGGAGTTCCTTTCACAGTCCTTTGATTTCCAAGAGTCGTGCAGCTGCTGGAGATGCTTATATGTTGTTAAACTTACATTCAGAGCTGGATGGACTTCACAGATGCCAGGCTCTCCTATAAGAGACAGGCCACAGATCCCAAAGTAGGCATGCAATGCATCTGGGTGGCTATCTGGCCATTTAGCAAAACCTCCAACAATGCGATCCTGGGTGGACAATATAAAATTTCTGTTTTTTTCAAAATTTGTATATTTGAAGATGTCCAACAGCATTAAAGTTGCTCCGACCCAAAAGGAATAACAAGTGTCAGCAGGTTTGTTTGGCCGTCCGTGAAAACCATTTTGTTGCCTCAATATGCACCACCTTCGCATTCTGTTCGGTTCCTTCTCTCAAAATACCTCCTCCAGTTTGCCCGTCAAGCAAAGGGAAGCAATTCCACCCAACGTATAGGCGCGCTGGGCTGCGGATCCGCCCCCGTGTCCCGGAGCGAGTTTGTATAACATACTCACTCCCATGTGATCAATCAATCCTGTGTGTATCATACCCCAACAGCTCGTGGAGCGTGGGGAGGGGGAGGAACAGGGAGGGGGAGAACTCCTTGTTGGTGTTTGTTTTTTTTTTCTCTCGGCAGCAGAGACGGTGGGCAAAGAACCTAAAAAAAAGGAGAGGACAGCCGAGGGGACCGGGGCGGGGTTGACAACAATATAAATATAGGTGGGCTATT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAGTTCCAATGTGCATATTATCGG