ORFeome > pgk1-prov ORF1 – XORFeome v1.0

pgk1-prov ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol:
Gene ID: 6256597
Gene Page ID:
ORF Xenbase ID: 17288925

ORF full-length analysis tests

Full-Length confidence: medium
Original XGC clone accession: BC043781
Original XGC clone length: 1254

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11011
Well Location: G03

Sequences - 5ʹ (forward) EST

Accession: JZ823888
dbEST ID: 79641590
Trimmed Sequence: ATGTCTCTGTCCAACAAGCTGACCCTGGATAAGGTTGATGTGAAAGGGAAAAGGGTAGTCATGAGGGTTGACTTCAATGTCCCAATGAAAAACAATCAGATTACAAACAACCAAAGGATTAAGGCTGCTGTTCCCAGCATCCAGCACTGTTTAGACCATGGTGCTAAATCTGTGGTTCTTATGAGCCACTTGGGCAGACCAGATGGGGTCCCTATGCCTGACAAGTACTCTCTGGCCCCAGTGGCTGAGGAACTCAAATCTCTGATGAAGAGAGAGATTGTCTTCTTGAAAGACTGTGTGGGTCCAGAAGTGGAAGCTGCATGTTCTGACCCAGCCACTGGAACAGTTTTACTTCTGGAGAACCTTCGCTTCCATGTGGAGGAAGAAGGGAAGGGTAAAGATGCTGCTGGGAACAAGATCAAAGCAGATGCTGCCAATGTAGATTCATTTAGAGCATCACTTTCTAAACTAGGAGATGTTTACATCAATGATGCTTTTGGAACTGCACACAGAGCTCACAGCTCCATGGTTGGTGTAAAGCTGCCCCAGAGGGCTGCTGGCTTTTTAATGAAGAAGGAGCTTGATTACTTTGCTAAGGCTTTGGAGAACCCTGAGAGACCTTTCCTTGCTATCCTTGGAGGTGCTAAAGTNAAGGACAAAATCCAGCTAATTAGTAACATGCTGGATCAAGTGAATGAATGATTATGGGGGTGGGTGGATGGCCTTTACCATTCCTGAANGGTCTCAACAATATGTCCCATTGGAACCTCCCTAATTTGATTGAAAAGGGAGCAAACAATTGTTTTAAGAACTTGATGGCCCAAAGCGAAAAAAAAAAAAGA
Full Trace Sequence: TAATGAATTTTAATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTCTCTGTCCAACAAGCTGACCCTGGATAAGGTTGATGTGAAAGGGAAAAGGGTAGTCATGAGGGTTGACTTCAATGTCCCAATGAAAAACAATCAGATTACAAACAACCAAAGGATTAAGGCTGCTGTTCCCAGCATCCAGCACTGTTTAGACCATGGTGCTAAATCTGTGGTTCTTATGAGCCACTTGGGCAGACCAGATGGGGTCCCTATGCCTGACAAGTACTCTCTGGCCCCAGTGGCTGAGGAACTCAAATCTCTGATGAAGAGAGAGATTGTCTTCTTGAAAGACTGTGTGGGTCCAGAAGTGGAAGCTGCATGTTCTGACCCAGCCACTGGAACAGTTTTACTTCTGGAGAACCTTCGCTTCCATGTGGAGGAAGAAGGGAAGGGTAAAGATGCTGCTGGGAACAAGATCAAAGCAGATGCTGCCAATGTAGATTCATTTAGAGCATCACTTTCTAAACTAGGAGATGTTTACATCAATGATGCTTTTGGAACTGCACACAGAGCTCACAGCTCCATGGTTGGTGTAAAGCTGCCCCAGAGGGCTGCTGGCTTTTTAATGAAGAAGGAGCTTGATTACTTTGCTAAGGCTTTGGAGAACCCTGAGAGACCTTTCCTTGCTATCCTTGGAGGTGCTAAAGTNAAGGACAAAATCCAGCTAATTAGTAACATGCTGGATCAAGTGAATGAATGATTATGGGGGTGGGTGGATGGCCTTTACCATTCCTGAANGGTCTCAACAATATGTCCCATTGGAACCTCCCTAATTTGATTGAAAAGGGAGCAAACAATTGTTTTAAGAACTTGATGGCCCAAAGCGAAAAAAAAAAAAGA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCTCTGTCCAACAAGCTGACC

Sequences - 3ʹ (reverse) EST

Accession: JZ829197
dbEST ID: 79646899
Trimmed Sequence: CACATTGCTCAGGGCATCAACTCCTGGTAGGACCTTTCCTTCTAGCAGCTCTAGACTGGCTCCTCCTCCTGTACTGACATGGCTAACTTTGTCCTCGGTATCCCATTTAGCACAGCAGGTAGCAGTGTCTCCTCCACCAATGATTGTAATGCAACCTTTGCCAGTGACCTCTACCACTTTGTCCATTACGGCTTTGGTTCCTTTAGCAAAATTGTCCCATTCAAACACCCCAACTGGACCATTCCACACAATCTGTTTGGCTCTGCCCACAGCTTCCACGAACAGCTTCACACTCTCTGGGCCACAGTCAAGTCCCATCCATCCATCAGGAATTCCAGTAGAGACGCTGGCTTGCCCTGTACTGGCATTTTCATCAAACTTGTTAGCAGTAGTAAAGTCTACAGGAAGTGTAATTTTGACTCCATTCTTCTCTGCCTTGGCCATCAAGTCCTTAACAATGTTTGCTCCCTCTTCATCATATAGGGAGGTTCCAATGGACATATTGTTGAGAACCTTCAGGAATGTAAAGGCCATCCCACCACCAATAATCATCTCATTCACTTGATCCAGCATGTTACTAATTAGCTGGATTTTGTCCTTTACTTTAGCACCTCCCAGGATAGCAAGGGAAAGGTCTCTCAGGGTTCTCCAAAGCCTTAACAAAATAATCAAGCTCCCTCTTCATTAAAAAGCCAGCACCCCTCTGGGGGCCACCTTTACACCA
Full Trace Sequence: TGACGGGTAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACACATTGCTCAGGGCATCAACTCCTGGTAGGACCTTTCCTTCTAGCAGCTCTAGACTGGCTCCTCCTCCTGTACTGACATGGCTAACTTTGTCCTCGGTATCCCATTTAGCACAGCAGGTAGCAGTGTCTCCTCCACCAATGATTGTAATGCAACCTTTGCCAGTGACCTCTACCACTTTGTCCATTACGGCTTTGGTTCCTTTAGCAAAATTGTCCCATTCAAACACCCCAACTGGACCATTCCACACAATCTGTTTGGCTCTGCCCACAGCTTCCACGAACAGCTTCACACTCTCTGGGCCACAGTCAAGTCCCATCCATCCATCAGGAATTCCAGTAGAGACGCTGGCTTGCCCTGTACTGGCATTTTCATCAAACTTGTTAGCAGTAGTAAAGTCTACAGGAAGTGTAATTTTGACTCCATTCTTCTCTGCCTTGGCCATCAAGTCCTTAACAATGTTTGCTCCCTCTTCATCATATAGGGAGGTTCCAATGGACATATTGTTGAGAACCTTCAGGAATGTAAAGGCCATCCCACCACCAATAATCATCTCATTCACTTGATCCAGCATGTTACTAATTAGCTGGATTTTGTCCTTTACTTTAGCACCTCCCAGGATAGCAAGGGAAAGGTCTCTCAGGGTTCTCCAAAGCCTTAACAAAATAATCAAGCTCCCTCTTCATTAAAAAGCCAGCACCCCTCTGGGGGCCACCTTTACACCA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACACATTGCTCAGGGCATC