ORFeome > pgm1 ORF1 – XORFeome v1.0

pgm1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: pgm1
Gene ID: 948534
Gene Page ID: 948526
ORF Xenbase ID: 17288937

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC043876
Original XGC clone length: 1689

Human orthology & disease relationships

NCBI Entrez ID: 5236
Ensembl gene IDs: ENSG00000079739
Directly associated (OMIM) disease MIM numbers: 614921
Indirectly associated (Lage, et al.) disease MIM numbers: 105400,125851,125853,151623,175200,194200,208000,223000,232600,235700,240600,248900,261750,275355,600858,602475,602485,602579,604931,606003,608611

Library Location

Plate ID: GDExl11011
Well Location: H11

Sequences - 5ʹ (forward) EST

Accession: JZ823886
dbEST ID: 79641588
Trimmed Sequence: ATGGTCAAAATCCAAACAGTCAAAACCAAGCCCTATACCGACCAGAAGCCGGGCACCAGCGGCCTCAGGAAGCGGGTCACTGTATTTCAGACCAACGCTAACTATGCAGAGAATTTCATTCAAAGTATCATCTCCTGCACGGAGCCTGCTGAGAGGCAGGACGGGGTCCTGGTGGTGGGAGGAGACGGCAGGTTTTACATGAAGGAAGCGATACAGCTCATCATCCAGATCGCAGCAGCTAATGGGATTGGACGCTTGGTTATTGGACAGAATGGCATTCTCTCTACTCCAGCAGTATCGTGCATCATCAGAAAAGTTAAAGCCAATGGTGGCATTATTTTGACCGCTAGCCATAACCCAGGGGGCCCAAATGGAGATTTTGGCATCAAGTTTAATACTTCCAATGGAGGTCCAGCGCCTGAAGCCATTACTGATAAGATTTTCCAGCTCAGTAAAACCATAGAAGAATATGCTATTTGCCCTGATCTTAAAGTCGATTTGGCTACAATTGGAAAACAACAGTTTGATTTGGAAAACAAATTCAAGCCATTTACTGTGGAGATTGTAGATTCGGTGGAAGCCTATGGAAACATGCTGAGAAATATATTTGACTTCAGTGCCCTAAAAGAGCTACTTTCTGGACAGAACAGGCTTAAAATTTCGAATGATGCATGCATGGGAGTTGTGGGTCTTTATGTGAAAAAGATCTTGTGGTGGAGATTGGGGAGCTCCTGCCCATTCTGCAGTAAACTGCATACCCCTGAGGAAATTTTGGAGGTCACCATCCCTAACCCAAATTTAAAATAGCTTTTTTAATTTTTGGAAAACCCTCAAAAAG
Full Trace Sequence: AAATGATTTTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGTCAAAATCCAAACAGTCAAAACCAAGCCCTATACCGACCAGAAGCCGGGCACCAGCGGCCTCAGGAAGCGGGTCACTGTATTTCAGACCAACGCTAACTATGCAGAGAATTTCATTCAAAGTATCATCTCCTGCACGGAGCCTGCTGAGAGGCAGGACGGGGTCCTGGTGGTGGGAGGAGACGGCAGGTTTTACATGAAGGAAGCGATACAGCTCATCATCCAGATCGCAGCAGCTAATGGGATTGGACGCTTGGTTATTGGACAGAATGGCATTCTCTCTACTCCAGCAGTATCGTGCATCATCAGAAAAGTTAAAGCCAATGGTGGCATTATTTTGACCGCTAGCCATAACCCAGGGGGCCCAAATGGAGATTTTGGCATCAAGTTTAATACTTCCAATGGAGGTCCAGCGCCTGAAGCCATTACTGATAAGATTTTCCAGCTCAGTAAAACCATAGAAGAATATGCTATTTGCCCTGATCTTAAAGTCGATTTGGCTACAATTGGAAAACAACAGTTTGATTTGGAAAACAAATTCAAGCCATTTACTGTGGAGATTGTAGATTCGGTGGAAGCCTATGGAAACATGCTGAGAAATATATTTGACTTCAGTGCCCTAAAAGAGCTACTTTCTGGACAGAACAGGCTTAAAATTTCGAATGATGCATGCATGGGAGTTGTGGGTCTTTATGTGAAAAAGATCTTGTGGTGGAGATTGGGGAGCTCCTGCCCATTCTGCAGTAAACTGCATACCCCTGAGGAAATTTTGGAGGTCACCATCCCTAACCCAAATTTAAAATAGCTTTTTTAATTTTTGGAAAACCCTCAAAAAG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGTCAAAATCCAAACAGTCAAA

Sequences - 3ʹ (reverse) EST

Accession: JZ829195
dbEST ID: 79646897
Trimmed Sequence: TGTGATAACAGTAGGAGCTGTGCGACCGGTTCTTTCCTGTAACTTTGAGATCTTTAGTGCAATGGTGATAAGAGGGGCCAAAATAACCTGAGGGTCTTCATATATTTTTTGTAAATCCTTCTCATAGCTGTCAATATATAATCTAATGGTAGCTCCAGCGCTGCCTGTACCACTAAGTCTGAAGATGATTCGAGATCCATCAGCAAAAATGAGCCTTAATCCCTGGTTTCTTGAAATGCTTCCATCGACGGGGTCACTATACTCAAAGTTATCTGCTTTTTCAACAGTATAAACTTTATCTCCAGCAGAAAGCTGCTGGCCAATGAATGAGCGATCAAACATCAATGCTTCAAGATCTTTCATCATTGTGTTAGCTCCTTCAGCATCAACCTCTTCATAATCATATCGTGTGAAAAAATTACGACCATACTTCTGCCAGTGATCTTTGAGAATTTCCTCCACACTCTGTTTGCGTGTGGCAATGATTGATAGCCATGCAAGAACTGCCCAAAGTCCATCCTTTTCTCGAATATGATCAGAGCCAGTTCCAAAACTTTCCTCTCCGCACAGGGACAGCTTGGTTGCATCCATTAAATTGCCCAAAGATTTTCCACCCCATTTGGAGTTTCATATAAAAGCAATCCTTGGTACC
Full Trace Sequence: CCGGCAGGGAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATGTGATAACAGTAGGAGCTGTGCGACCGGTTCTTTCCTGTAACTTTGAGATCTTTAGTGCAATGGTGATAAGAGGGGCCAAAATAACCTGAGGGTCTTCATATATTTTTTGTAAATCCTTCTCATAGCTGTCAATATATAATCTAATGGTAGCTCCAGCGCTGCCTGTACCACTAAGTCTGAAGATGATTCGAGATCCATCAGCAAAAATGAGCCTTAATCCCTGGTTTCTTGAAATGCTTCCATCGACGGGGTCACTATACTCAAAGTTATCTGCTTTTTCAACAGTATAAACTTTATCTCCAGCAGAAAGCTGCTGGCCAATGAATGAGCGATCAAACATCAATGCTTCAAGATCTTTCATCATTGTGTTAGCTCCTTCAGCATCAACCTCTTCATAATCATATCGTGTGAAAAAATTACGACCATACTTCTGCCAGTGATCTTTGAGAATTTCCTCCACACTCTGTTTGCGTGTGGCAATGATTGATAGCCATGCAAGAACTGCCCAAAGTCCATCCTTTTCTCGAATATGATCAGAGCCAGTTCCAAAACTTTCCTCTCCGCACAGGGACAGCTTGGTTGCATCCATTAAATTGCCCAAAGATTTTCCACCCCATTTGGAGTTTCATATAAAAGCAATCCTTGGTACC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATGTGATAACAGTAGGAGCTGTG