ORFeome > phc1 ORF1 – XORFeome v1.0

phc1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: phc1
Gene ID: 1013251
Gene Page ID: 1013247
ORF Xenbase ID: 17289021

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC125982
Original XGC clone length: 2532

Human orthology & disease relationships

NCBI Entrez ID: 1911
Ensembl gene IDs: ENSG00000111752
Directly associated (OMIM) disease MIM numbers: 615414
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11088
Well Location: A02

Sequences - 5ʹ (forward) EST

Accession: JZ838190
dbEST ID: 79655892
Trimmed Sequence: ATGGAAACAGAGAGTGAACAGAATTCTGGCTCCACCAATGGGAGTTCAGCGTCGGGGAGCAGTACGCGCCCTCAGATATCACAGATGTCTCTTTATGAACGGCAAGCTGTACAGGCCCTGCAGGCTCTCCACAGACAGCCAAACGCTGCTCAGTATTTCCACCAGTTGATGCTACAACAGCAGCTGAGTAATGCCCAGTTACATAGCCTGGCAGCTGTTCAGCAGGCAACAATTGCTGCGAGTCGACAAGCTGCATCTCCCAACACAGGCTCTGGCCAACAGACAAACACCACACAGGGATCTGCCAACCTTTCCACAAGCTCTTCAGCCCAGCTCCTAAGCCGTACGCAGAATGTGACCGCACCCAGTGCCACGACCCTCACGCAGTCGGTGTTGCTTAGTAACAGCAGCTCGCCATCTCTTGGGCAGTCACAAACACCAGTGTACCTGCGTCAGCCACAGCTAGGAAACCTTTTACAGGTGAACCGGTCACTTTGGGCGTGNGGTTCCACTGAACTCACAGCTCATTTTGATGCCCAACGGATCGGTAGCAGTCCAGCAGGAGGTGACATCTCCCCAGAACCAAGGAGTACACCAGGACTCTGATCAGGTTCAGAATTTGGGCGTTCGGGGGCCAGCGACAGCTGCGACTACTTCTACTATTTCTCATCCCGCTTCTCTAACTACAAAACCCCCA
Full Trace Sequence: CTCGTGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGAAACAGAGAGTGAACAGAATTCTGGCTCCACCAATGGGAGTTCAGCGTCGGGGAGCAGTACGCGCCCTCAGATATCACAGATGTCTCTTTATGAACGGCAAGCTGTACAGGCCCTGCAGGCTCTCCACAGACAGCCAAACGCTGCTCAGTATTTCCACCAGTTGATGCTACAACAGCAGCTGAGTAATGCCCAGTTACATAGCCTGGCAGCTGTTCAGCAGGCAACAATTGCTGCGAGTCGACAAGCTGCATCTCCCAACACAGGCTCTGGCCAACAGACAAACACCACACAGGGATCTGCCAACCTTTCCACAAGCTCTTCAGCCCAGCTCCTAAGCCGTACGCAGAATGTGACCGCACCCAGTGCCACGACCCTCACGCAGTCGGTGTTGCTTAGTAACAGCAGCTCGCCATCTCTTGGGCAGTCACAAACACCAGTGTACCTGCGTCAGCCACAGCTAGGAAACCTTTTACAGGTGAACCGGTCACTTTGGGCGTGNGGTTCCACTGAACTCACAGCTCATTTTGATGCCCAACGGATCGGTAGCAGTCCAGCAGGAGGTGACATCTCCCCAGAACCAAGGAGTACACCAGGACTCTGATCAGGTTCAGAATTTGGGCGTTCGGGGGCCAGCGACAGCTGCGACTACTTCTACTATTTCTCATCCCGCTTCTCTAACTACAAAACCCCCA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAAACAGAGAGTGAACAGA

Sequences - 3ʹ (reverse) EST

Accession: JZ838189
dbEST ID: 79655891
Trimmed Sequence: GGTCTCCTTGAGCAGGTTTATTTTAGCACAGATTTTCAGCGCAGGTCCTAGTTTAATGTTAAGGGCGCTCATGAGATGTTCTTCCTTCAGCAGCAGCAAGGCCTGCCCGTCGATCTCTTGAGAGCGGAAGTCTTCAGCTAAATCTTGGCAACCTTGCAGAGAGGAGATGAACTCGTACACCTCTTCTACACTCCAGTGGCTGGGGTTACTGGAGAGGAACATGGGATTAATTCCCAGAAGGTCAGAGTTTGAGGGTCCACTTGTTGGGGTGCCACCATCTCTGTCGCCGTGTGGCGTTCTGCAAGACGGTGGGACGGGGGAGTTAGGAGAGAAGGCTTCATCATAGCTGGAATTATCGGACCCTCTGCTGGAATCCTCCCGCATCCTGTTCCCTTGGATCTTTGCTCGCGCTATCTCTGAACTGTTCCTGCGAGGGCCGCGCCTTCGAGCTCTCACACCTCCACCTTCCTGCAGCTCTTTCAGTTTCTTTCGTTTGAGTCTGAATTGGTGGCTACAGCTGACGTTATATCTTTTGGCACAAGTCATGGAACAGAATCGTTTGGAGCCGCGGAACTGCTCGGCAGGGGCGTACTTGCCACAGTACTCACATTTTAACAGCTTGGAGCTTCCAAATCGCTGGCAACTGTATCTCCCCCGGGCTGGTGGAGGTGGGCTCCTCGGCTGGGGGTAGAACAATCTCGGAAAAAAGTTTTCCTTTCTCAGGTTCCCTTTTACGCAATTTAGGGGCCTGCCCCCCAAAGGGGAA
Full Trace Sequence: GGGAAACTGCTATGGACCATGTAATACGACTCACTATAGGGGATATCAGCGTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGGTCTCCTTGAGCAGGTTTATTTTAGCACAGATTTTCAGCGCAGGTCCTAGTTTAATGTTAAGGGCGCTCATGAGATGTTCTTCCTTCAGCAGCAGCAAGGCCTGCCCGTCGATCTCTTGAGAGCGGAAGTCTTCAGCTAAATCTTGGCAACCTTGCAGAGAGGAGATGAACTCGTACACCTCTTCTACACTCCAGTGGCTGGGGTTACTGGAGAGGAACATGGGATTAATTCCCAGAAGGTCAGAGTTTGAGGGTCCACTTGTTGGGGTGCCACCATCTCTGTCGCCGTGTGGCGTTCTGCAAGACGGTGGGACGGGGGAGTTAGGAGAGAAGGCTTCATCATAGCTGGAATTATCGGACCCTCTGCTGGAATCCTCCCGCATCCTGTTCCCTTGGATCTTTGCTCGCGCTATCTCTGAACTGTTCCTGCGAGGGCCGCGCCTTCGAGCTCTCACACCTCCACCTTCCTGCAGCTCTTTCAGTTTCTTTCGTTTGAGTCTGAATTGGTGGCTACAGCTGACGTTATATCTTTTGGCACAAGTCATGGAACAGAATCGTTTGGAGCCGCGGAACTGCTCGGCAGGGGCGTACTTGCCACAGTACTCACATTTTAACAGCTTGGAGCTTCCAAATCGCTGGCAACTGTATCTCCCCCGGGCTGGTGGAGGTGGGCTCCTCGGCTGGGGGTAGAACAATCTCGGAAAAAAGTTTTCCTTTCTCAGGTTCCCTTTTACGCAATTTAGGGGCCTGCCCCCCAAAGGGGAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGGTCTCCTTGAGCAGGT