ORFeome > phf12 ORF1 – XORFeome v1.0

phf12 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: phf12
Gene ID: 968354
Gene Page ID: 968348
ORF Xenbase ID: 17289039

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC043787
Original XGC clone length: 2937

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11011
Well Location: B07

Sequences - 5ʹ (forward) EST

Accession: JZ823936
dbEST ID: 79641638
Trimmed Sequence: ATGGAGACCAAAACCATCGTGTACGATCTGGACACCTCTGGGGGTCTAATGGAGCAAATTCAAGCACTGCTGGCTCCACCAAAGAGTGAAGAAGGGGAGAAGAAAAGTAAGAGGCTAGAAAAGGAACCCAGGAGAAGTGGAAGGGCCACCAACCATGATAGCTGTGATAGCTGTAAGGAGGGTGGTGATCTCCTGTGCTGTGACCACTGTCCGGCTGCATTCCACCTCCAGTGTTGCAACCCTCCACTGAGTGAAGAGATGTTGCCTCCAGGAGAGTGGATGTGTCATCGCTGCTCTATACGCAGGAAGAAACGTGAACGTAAGAAGGAGTTGGGGCAGGTAAATGGTCTGTTTGACAGATATGGAAGGAGGACTGCTTCCCCAACCAGTGATCTGGATTTCTCGGAGAAAGCTCCTGGCACTTTCCGAGCCCTTGCACAAGCCAGAATGCTGGAAAGGAGAGTCAGTCGCCCCGGAACCCCAACATCCAGCGCCAGCACTGATACTCCAACTTCTGAGCAGAATGATGTGGATGAGGACATGATTGATATGGACGATGAACCAACTGCTTTGGACTCTGAGTGCAGCCATTCTCAGCTCAAGAGACCTTTCCAGCTGCTCATTGCTGCAGCTATGGAGAGGAACCCTACCCAGTTCCAGCTGCCCCATGAACTTACATGCACCACTGCACTTCCAGGCACCANCAAGCGGCGTAAGAAAGAAGAAATGTCGGGAAAGAATGTCAAGAAGGCCAGCACGAATTGGATCCAAGGGGCGTGGTTCTTTTTCCGGTTAAAGTTGGCTTCACTTGTAAAAGGGAGCTGTCGAAGTGCCC
Full Trace Sequence: CAATATTGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGAGACCAAAACCATCGTGTACGATCTGGACACCTCTGGGGGTCTAATGGAGCAAATTCAAGCACTGCTGGCTCCACCAAAGAGTGAAGAAGGGGAGAAGAAAAGTAAGAGGCTAGAAAAGGAACCCAGGAGAAGTGGAAGGGCCACCAACCATGATAGCTGTGATAGCTGTAAGGAGGGTGGTGATCTCCTGTGCTGTGACCACTGTCCGGCTGCATTCCACCTCCAGTGTTGCAACCCTCCACTGAGTGAAGAGATGTTGCCTCCAGGAGAGTGGATGTGTCATCGCTGCTCTATACGCAGGAAGAAACGTGAACGTAAGAAGGAGTTGGGGCAGGTAAATGGTCTGTTTGACAGATATGGAAGGAGGACTGCTTCCCCAACCAGTGATCTGGATTTCTCGGAGAAAGCTCCTGGCACTTTCCGAGCCCTTGCACAAGCCAGAATGCTGGAAAGGAGAGTCAGTCGCCCCGGAACCCCAACATCCAGCGCCAGCACTGATACTCCAACTTCTGAGCAGAATGATGTGGATGAGGACATGATTGATATGGACGATGAACCAACTGCTTTGGACTCTGAGTGCAGCCATTCTCAGCTCAAGAGACCTTTCCAGCTGCTCATTGCTGCAGCTATGGAGAGGAACCCTACCCAGTTCCAGCTGCCCCATGAACTTACATGCACCACTGCACTTCCAGGCACCANCAAGCGGCGTAAGAAAGAAGAAATGTCGGGAAAGAATGTCAAGAAGGCCAGCACGAATTGGATCCAAGGGGCGTGGTTCTTTTTCCGGTTAAAGTTGGCTTCACTTGTAAAAGGGAGCTGTCGAAGTGCCC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAGACCAAAACCATCGTGTA

Sequences - 3ʹ (reverse) EST

Accession: JZ829245
dbEST ID: 79646947
Trimmed Sequence: AGGAACAGAACTGGAGCGTAGGACCGACACCTGGTGAGGGGGTTTGAGAGACAATTTGTTGTCCAAGTCCAGCTCTTGTGCTAAGGCATCGCTTTCACCTTTGGGCTGCCTGCTTGCAAACTCCGTGATTGAGAAGAGAAACTGGATACAACCCAACTTAATATAACTTCCATGGTGCAAAAGGGCGGTGCCTTCCCAGCCGGCTCCACTTCCTCCAATGAGACTGGAGCTGCTGGCTTTGCAGTTACACGACTGCTGACCAGGGCCTTGGGCCTGACAGTTCATAACGGCTTCTTCTTTCACTGCCTCTTCCTCAGGATTTTGGCTTTTGTGGCGTTTTGAAACACTTTGCACTTTGGCAACAATACTGCTTGGTGGGGTCGGGATGATTTTCTCCGAGAAATCACAGGAATAGAGCACGTTGTCCACAGTCGTTCCATGTTCACTGTAATTTAACAGCTCATAATGCTTTGTGTTTTCATCGTAAAATATACAGGCGTGTTTGCCGGACACATAGTTGCAGTGGCCATAATTTGTAAGGCACACGTCCATGTCTGCTCCTGTGCCAATGTAGAGAGTCCGGTAGCACATATTCACAGGAGCTCCAACACCCATCATTAGAGGGTAGAATACAGCCCTGGCTTGTACATCTTTTTTCTGGGCTTCTAAAGTGGTTTGTGAGTGAAGGTGCTACCAGGACGGGGGAACCCTTTGCTTACAG
Full Trace Sequence: GGGCGTGTATCAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAGGAACAGAACTGGAGCGTAGGACCGACACCTGGTGAGGGGGTTTGAGAGACAATTTGTTGTCCAAGTCCAGCTCTTGTGCTAAGGCATCGCTTTCACCTTTGGGCTGCCTGCTTGCAAACTCCGTGATTGAGAAGAGAAACTGGATACAACCCAACTTAATATAACTTCCATGGTGCAAAAGGGCGGTGCCTTCCCAGCCGGCTCCACTTCCTCCAATGAGACTGGAGCTGCTGGCTTTGCAGTTACACGACTGCTGACCAGGGCCTTGGGCCTGACAGTTCATAACGGCTTCTTCTTTCACTGCCTCTTCCTCAGGATTTTGGCTTTTGTGGCGTTTTGAAACACTTTGCACTTTGGCAACAATACTGCTTGGTGGGGTCGGGATGATTTTCTCCGAGAAATCACAGGAATAGAGCACGTTGTCCACAGTCGTTCCATGTTCACTGTAATTTAACAGCTCATAATGCTTTGTGTTTTCATCGTAAAATATACAGGCGTGTTTGCCGGACACATAGTTGCAGTGGCCATAATTTGTAAGGCACACGTCCATGTCTGCTCCTGTGCCAATGTAGAGAGTCCGGTAGCACATATTCACAGGAGCTCCAACACCCATCATTAGAGGGTAGAATACAGCCCTGGCTTGTACATCTTTTTTCTGGGCTTCTAAAGTGGTTTGTGAGTGAAGGTGCTACCAGGACGGGGGAACCCTTTGCTTACAG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAGGAACAGAACTGGAGCGTAGGA