ORFeome > phf23 ORF2 – XORFeome v1.0

phf23 ORF2 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: phf23
Gene ID: 6252782
Gene Page ID: 6485525
ORF Xenbase ID: 17289063

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC123233
Original XGC clone length: 810

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11088
Well Location: H11

Sequences - 5ʹ (forward) EST

Accession: JZ838235
dbEST ID: 79655937
Trimmed Sequence: ATGCTGGAGACAACCAATGGGGAGGCGAGTCCTGAAGATCCACCGCTGAACCTCAAGTCTCTGTCTCAGCCCCCCCAGAAACGCTCGCGCACGGTGGAAGACTTTAATCGATTTTGCAGTTTCGTGCTGACGTACGCTGGGTACATCCCCACCCCCGCTACAGAGGAGCGTCCATGGACCCCTCCAAGCTCTGTGTCTCCCCACCGAACAGAGGAAAGCGACGGCTGGGACTCCTCCCCACAACTCCCAGTACCCTCTGACCCCCCTCAACCCCCCGCAACCTCTGATATCAGCACTATTGAGACTTTTGTTATGAAAGCCAAGTCCCAGGGAGGGGGGGGCAACAGCATCATGAAGACTGGGGGGCCCATAGGCGGCAGCGGGGAGCAAGTGAAAAAGGGCAGTCGCAGGAAAAGGCGGCAGTTGCACCGGGGGGGCGTGACGATGAGTGATACGGATACGGACGAGGAGGAGAGGGACAAAAACCCGCGGGGTCACTACCTGCCCCCCAACTGCCCCCCATTGCATAAAGCAGCCGAGATGGAGGCGGGAGCTCCACTGATACCGACACCCAAGTGATGAATGAGGATATAATGGTGGAGTCAGGGGACGACTCATGGGGACCTGGTGAACGTGTTACTGTAAAAAGCCGTTTGCTTGGCCGGCCGATGATCAAATTGTAACATTTTGCTCACCTTGGGTTGCCCTTGTCCCTGCGCAAAAAATGCGCAGAAAATAACCTTCCCTGGCTGTTATTAATCTCCCAAAAGTTTCCGGGGGGGGGGAGGGGGGGGGGGGGGGGGGGGGGGGGGGCCGGGGGGGGAAGAAGCC
Full Trace Sequence: TCGAGGGCCCAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCTGGAGACAACCAATGGGGAGGCGAGTCCTGAAGATCCACCGCTGAACCTCAAGTCTCTGTCTCAGCCCCCCCAGAAACGCTCGCGCACGGTGGAAGACTTTAATCGATTTTGCAGTTTCGTGCTGACGTACGCTGGGTACATCCCCACCCCCGCTACAGAGGAGCGTCCATGGACCCCTCCAAGCTCTGTGTCTCCCCACCGAACAGAGGAAAGCGACGGCTGGGACTCCTCCCCACAACTCCCAGTACCCTCTGACCCCCCTCAACCCCCCGCAACCTCTGATATCAGCACTATTGAGACTTTTGTTATGAAAGCCAAGTCCCAGGGAGGGGGGGGCAACAGCATCATGAAGACTGGGGGGCCCATAGGCGGCAGCGGGGAGCAAGTGAAAAAGGGCAGTCGCAGGAAAAGGCGGCAGTTGCACCGGGGGGGCGTGACGATGAGTGATACGGATACGGACGAGGAGGAGAGGGACAAAAACCCGCGGGGTCACTACCTGCCCCCCAACTGCCCCCCATTGCATAAAGCAGCCGAGATGGAGGCGGGAGCTCCACTGATACCGACACCCAAGTGATGAATGAGGATATAATGGTGGAGTCAGGGGACGACTCATGGGGACCTGGTGAACGTGTTACTGTAAAAAGCCGTTTGCTTGGCCGGCCGATGATCAAATTGTAACATTTTGCTCACCTTGGGTTGCCCTTGTCCCTGCGCAAAAAATGCGCAGAAAATAACCTTCCCTGGCTGTTATTAATCTCCCAAAAGTTTCCGGGGGGGGGGAGGGGGGGGGGGGGGGGGGGGGGGGGGGCCGGGGGGGGAAGAAGCC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCTGGAGACAACCAATGGGGA

Sequences - 3ʹ (reverse) EST

Accession: JZ838234
dbEST ID: 79655936
Trimmed Sequence: TGGCTCTTCCTTTAGCGCTGTGCCCCCTGACCCCCGTCCCCCCCTGCACTTCTGGCAGTAATAGACATCAGGGACGTTACTCTTGCGGATCTTTGCGCAGGACAAGTGCACCCACGTGCAGCAAATGTTACACTCGATCATCGGCCGCCCAGCGAACGGCTTCTCACAGTAACACGTCACCAGGTCCCACGAGTCGTCCCCTGACTCCACCATAATATCCTCATCCATCACTTGGGTGTCGGTATCACTGGAGCTCCCGCCTCCATCTCGGCTGCTTTCTGCACTGGGGGGCAGTTGGGGGGCAGGTAGTGACCCCGCGGGTCTCTTGTCCCTCTCCTCCTCGTCCGTATCCGTATCACTCATCGTCACACCGCCCCGGTGCAACTGCCGCCTTTTCCTGCGACTGCCCTTTTTCACTTGCTCCCCGCTGCCGCCTATGGGCCCCCCAGTCTTCATAATGCGATTGCCCCCCCCTCCCCTCGGCTTGGCTTTCATAACAAAAATCTCAGTATTGCTGATAACAGAAGTTGCGGGGGATGAGGGGAGGTGGGAGGATACGGGAATTGAANTTGGGGGGGGGGGAAATCNTCCTTCGCGCCTTCTTCGTGGGGGGGGGNGGGAAGGGGGGAGAAGGGGGGGCCACGGGGCCCCCCCCTTTTTNNGGGGGGGAGGGGGGGGGAGGNAGGAGGGAGGGNGGGGGGGGGAAAAGAGGGAAAAAAAAGGAGGGGGGGGGGGGGGGGGGGGGGGGGGGGTGGGGGGGGGGGGGGG
Full Trace Sequence: GGAAATCTGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCGTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATGGCTCTTCCTTTAGCGCTGTGCCCCCTGACCCCCGTCCCCCCCTGCACTTCTGGCAGTAATAGACATCAGGGACGTTACTCTTGCGGATCTTTGCGCAGGACAAGTGCACCCACGTGCAGCAAATGTTACACTCGATCATCGGCCGCCCAGCGAACGGCTTCTCACAGTAACACGTCACCAGGTCCCACGAGTCGTCCCCTGACTCCACCATAATATCCTCATCCATCACTTGGGTGTCGGTATCACTGGAGCTCCCGCCTCCATCTCGGCTGCTTTCTGCACTGGGGGGCAGTTGGGGGGCAGGTAGTGACCCCGCGGGTCTCTTGTCCCTCTCCTCCTCGTCCGTATCCGTATCACTCATCGTCACACCGCCCCGGTGCAACTGCCGCCTTTTCCTGCGACTGCCCTTTTTCACTTGCTCCCCGCTGCCGCCTATGGGCCCCCCAGTCTTCATAATGCGATTGCCCCCCCCTCCCCTCGGCTTGGCTTTCATAACAAAAATCTCAGTATTGCTGATAACAGAAGTTGCGGGGGATGAGGGGAGGTGGGAGGATACGGGAATTGAANTTGGGGGGGGGGGAAATCNTCCTTCGCGCCTTCTTCGTGGGGGGGGGNGGGAAGGGGGGAGAAGGGGGGGCCACGGGGCCCCCCCCTTTTTNNGGGGGGGAGGGGGGGGGAGGNAGGAGGGAGGGNGGGGGGGGGAAAAGAGGGAAAAAAAAGGAGGGGGGGGGGGGGGGGGGGGGGGGGGGGTGGGGGGGGGGGGGGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATGGCTCTTCCTTTAGCGCTGT