ORFeome > phlda1 ORF1 – XORFeome v1.0

phlda1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: phlda1
Gene ID: 946946
Gene Page ID: 946940
ORF Xenbase ID: 17289093

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC129674
Original XGC clone length: 447

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11091
Well Location: A01

Sequences - 5ʹ (forward) EST

Accession: JZ838674
dbEST ID: 79656376
Trimmed Sequence: ATGTTGGAAAGCAGCTGTAAGGTGGTGAAGGAGGGACTGCTGGAGAAGAGGAGTGATGGCTTACTGCAGCTGTGGAAGAAGAAGCGCTGCATTCTCACCGAGGAAGGACTTCTGCTCATCCCTCCCAAACAGCTGGAGCAGCAGCAACAGCCAAGTCAGCCAGCCGAGCCCGCAAGGATCAAGGAGCTACACTTCTCCAACATGAAGACAGTGGACTGCGTGGAGAGGAAAGGCAAATACGTGTATTTCACGGTGGTGATGACAGAGGGGAGGGAGATAGATTTTCGGTGCCCGCAGGACCAGGGCTGGAATGCAGAGATCACCCTGCANATGGTGCAGTACAAGAACAGACAGGCGATACTGGCAGTGAAATCCACCCGACAGAAACAGCAGCACCTGGTCCAGCCGCATGGGCACCGCATCAAGAGCGCCTCCGACTCTGCATT
Full Trace Sequence: CTCGAGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTTGGAAAGCAGCTGTAAGGTGGTGAAGGAGGGACTGCTGGAGAAGAGGAGTGATGGCTTACTGCAGCTGTGGAAGAAGAAGCGCTGCATTCTCACCGAGGAAGGACTTCTGCTCATCCCTCCCAAACAGCTGGAGCAGCAGCAACAGCCAAGTCAGCCAGCCGAGCCCGCAAGGATCAAGGAGCTACACTTCTCCAACATGAAGACAGTGGACTGCGTGGAGAGGAAAGGCAAATACGTGTATTTCACGGTGGTGATGACAGAGGGGAGGGAGATAGATTTTCGGTGCCCGCAGGACCAGGGCTGGAATGCAGAGATCACCCTGCANATGGTGCAGTACAAGAACAGACAGGCGATACTGGCAGTGAAATCCACCCGACAGAAACAGCAGCACCTGGTCCAGCCGCATGGGCACCGCATCAAGAGCGCCTCCGACTCTGCATTGCCTACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGACCAGGTCACTATCAATCAAAATAAAATCATTATTTGCCCTCCAGCATATAACCCAAATAGTAAGATCAGAGAACAGGTCGTGACCTGTTTTAAAAAAAAAAAAAAAAAAAAAATATAATTTTGCCACCTTTAAAGAACGGGGGGGGGATAAGACCAAAATATGCTTGCTCCCAGAGAGGGGGGGTGTCGTACCTTGGTATTTGGGGGGGGGAAAAAAAACAAAAAAAAAAAAAACAGTTAGGGGGTGATGGGTATTGTGGGTTGTAAAACAGAACACCCCCCGCGCGGGGGGGA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTTGGAAAGCAGCTGTAAGGT

Sequences - 3ʹ (reverse) EST

Accession: JZ838673
dbEST ID: 79656375
Trimmed Sequence: TGCAGAGTTGGAGGCGCTCCTGATGCGGTGCCCATGCGGCTGGACCAGGTGCTGCTGTTTCTGTCGGGTGGATTTCACTGCCAGTATCGCCTGTCTGTTCTTGTACTGCACCATCTGCAGGGTGATCTCTGCATTCCAGCCCTGGTCCTGCGGGCACCGAAAATCTATCTCCCTCCCCTCTGTCATCACCACCGTGAAATACACGTATTTGCCTTTCCTCTCCACGCAGTCCACTGTCTTCATGTTGGAGAAGTGTAGCTCCTTGATCCTTGCGGGCTCGGCTGGCTGACTTGGCTGATGCTGCTGCTCCTGCTGTTTGGGAAGTATGAACAGAATTCCTTCCTCGAGGAGAATGCATGGCTTCTTCTTCCAGAGCTGCAGTAAGCCATCACTCCTCTTCTCCAGCAGTCCCTCCTACACCACCATTCACCTGCTTTCCAACATGGTGCGAGCTTTTTTGTACGACGTTGGGGATTAGCAAAACCATTCCTCATCAATTAGTTGCAACGAGCAGGTCACTAGCAGCCAAAATAAATCGTTATTTGTNGGNAAAAAAGGAAAAAGAACAAAAATATTATTTCCCCTCGTTTGGGACGCCCGGGGCAAAGGCCCAACACGGGGCTTCCAAAGAAGGGGGGGTTCGCTTCTGGGTGAGGGAGAGAGAAGAACACCGGGGCGAGAAACCTCTGCGGGGGGGGGGAGGGGGGGGGGAAGGGGGCGGGCCGGAGGGGGCGCAACAAACCTCCCACCCCCCCGCCGG
Full Trace Sequence: GGGAAAACGGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATGCAGAGTTGGAGGCGCTCCTGATGCGGTGCCCATGCGGCTGGACCAGGTGCTGCTGTTTCTGTCGGGTGGATTTCACTGCCAGTATCGCCTGTCTGTTCTTGTACTGCACCATCTGCAGGGTGATCTCTGCATTCCAGCCCTGGTCCTGCGGGCACCGAAAATCTATCTCCCTCCCCTCTGTCATCACCACCGTGAAATACACGTATTTGCCTTTCCTCTCCACGCAGTCCACTGTCTTCATGTTGGAGAAGTGTAGCTCCTTGATCCTTGCGGGCTCGGCTGGCTGACTTGGCTGATGCTGCTGCTCCTGCTGTTTGGGAAGTATGAACAGAATTCCTTCCTCGAGGAGAATGCATGGCTTCTTCTTCCAGAGCTGCAGTAAGCCATCACTCCTCTTCTCCAGCAGTCCCTCCTACACCACCATTCACCTGCTTTCCAACATGGTGCGAGCTTTTTTGTACGACGTTGGGGATTAGCAAAACCATTCCTCATCAATTAGTTGCAACGAGCAGGTCACTAGCAGCCAAAATAAATCGTTATTTGTNGGNAAAAAAGGAAAAAGAACAAAAATATTATTTCCCCTCGTTTGGGACGCCCGGGGCAAAGGCCCAACACGGGGCTTCCAAAGAAGGGGGGGTTCGCTTCTGGGTGAGGGAGAGAGAAGAACACCGGGGCGAGAAACCTCTGCGGGGGGGGGGAGGGGGGGGGGAAGGGGGCGGGCCGGAGGGGGCGCAACAAACCTCCCACCCCCCCGCCGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATGCAGAGTTGGAGGCGCT