ORFeome > phox2a ORF1 – XORFeome v1.0

phox2a ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: phox2a
Gene ID: 853858
Gene Page ID: 853856
ORF Xenbase ID: 17289111

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC124891
Original XGC clone length: 846

Human orthology & disease relationships

NCBI Entrez ID: 401
Ensembl gene IDs: ENSG00000165462
Directly associated (OMIM) disease MIM numbers: 602078
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11092
Well Location: G01

Sequences - 5ʹ (forward) EST

Accession: JZ838831
dbEST ID: 79656533
Trimmed Sequence: ATGTACAAAATGGATTATTCTTACCTCAACTCGTATGACTCGTGTATGGCGGCCATGGAAGCCTCCGCCTATGCGGATTTCAGCTCGTGCAGTCAGCCCAACAGCTTCCAGTACAATCCCATCAGGAGCAGCTTTGGGGCCAACCCGGCCTGCCCCCCACTCACTACTGCCAACTGCACCCTGGGGGCCCTCAGAGACCATCAGCCTTCTCCTTACTCTACAGTTCCCTACAAGTTCTTCTCAGACCCATCAGGCATTAACGAGAAGAGGAAGCAGAGGAGGATCCGGACCACCTTCACCAGCTCCCAACTCAAAGAGCTTGAGAGGGTATTTGCCGAGACTCACTACCCCGACATCTACACCCGAGAGGAGCTGGCACTCAAGATCGACCTGACGGAGGCCCGTGTCCAGGTCTGGTTCCAGAATCGACGGGCCGAGTTCCGCAAGCAGGAGAGGGCAACCAACTCCAAGGGTGGAAGTTCCACCAATGGAGGATCTGGCAATAAGAAGTCCGATGGACGTTCCTCTTCAAAAGACGATGAATTCAAGGAGTTCAACTGGCGTCCAACCCCAAACAGTACTGCTTCTCTGCCCACCGCGGGCAACCTCAAAAACCCCTGGGGGAGCTTGAGCCCAGCCCCTGGGGCGGCTTCGGGGCATTTTCCCAGCAACAAGGTGCAGACCCTCAAAAGGCCGATTCTGGCCTGGGTTCCGAATTTTCATCAGACCGAGCAAAGCGTAACTTCCTTAAGACGGGTGGGGCCCACCCCAACACGATGGGCCGGGCGCGGGTTTGTCGGTTGGTGCGCGCCCTCCGGGTA
Full Trace Sequence: CTCGAGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTACAAAATGGATTATTCTTACCTCAACTCGTATGACTCGTGTATGGCGGCCATGGAAGCCTCCGCCTATGCGGATTTCAGCTCGTGCAGTCAGCCCAACAGCTTCCAGTACAATCCCATCAGGAGCAGCTTTGGGGCCAACCCGGCCTGCCCCCCACTCACTACTGCCAACTGCACCCTGGGGGCCCTCAGAGACCATCAGCCTTCTCCTTACTCTACAGTTCCCTACAAGTTCTTCTCAGACCCATCAGGCATTAACGAGAAGAGGAAGCAGAGGAGGATCCGGACCACCTTCACCAGCTCCCAACTCAAAGAGCTTGAGAGGGTATTTGCCGAGACTCACTACCCCGACATCTACACCCGAGAGGAGCTGGCACTCAAGATCGACCTGACGGAGGCCCGTGTCCAGGTCTGGTTCCAGAATCGACGGGCCGAGTTCCGCAAGCAGGAGAGGGCAACCAACTCCAAGGGTGGAAGTTCCACCAATGGAGGATCTGGCAATAAGAAGTCCGATGGACGTTCCTCTTCAAAAGACGATGAATTCAAGGAGTTCAACTGGCGTCCAACCCCAAACAGTACTGCTTCTCTGCCCACCGCGGGCAACCTCAAAAACCCCTGGGGGAGCTTGAGCCCAGCCCCTGGGGCGGCTTCGGGGCATTTTCCCAGCAACAAGGTGCAGACCCTCAAAAGGCCGATTCTGGCCTGGGTTCCGAATTTTCATCAGACCGAGCAAAGCGTAACTTCCTTAAGACGGGTGGGGCCCACCCCAACACGATGGGCCGGGCGCGGGTTTGTCGGTTGGTGCGCGCCCTCCGGGTA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTACAAAATGGATTATTCTTAC

Sequences - 3ʹ (reverse) EST

Accession: JZ838830
dbEST ID: 79656532
Trimmed Sequence: AAACAGATTTGCCTTCAGGGTATTGGGCTTTCTATGAAATGTGGAGAGGACACCAGCAAATGGGCCAGGCACTGCGTCGGCTGGTTGCCAGGCTTTGAGGAGCTCAGCTGTGCTGGTGCTGCTGCTACTTGGGACTCCAGGCCAGACTGGGCCCTTGAGGGTCTGCACCGTGTGGGTTGGCACAAGGCCTGAAGCTGCACCAGGGCTGGGGCTCAAGCTTCCCCCAGGGCTATTGAGGTTGCCCGCGGTGGGCAGAGAAGCAGTACTGTCTGGGGTTGGACTGCAGTTGGACTCCTTGGATTCATCGTCTTCTGAAGAGGAACGTCCATCGGACTTCTTATTGCCAGATCCTCCATTGTTGGAACTTCCACCCTTGGAGTTGGTTGCCCTCTCCTGCTTGCGGAACTTGGCCCGTCGATTCTGGAACCAGACCTGGACACGGGCCTCCGTCAGGTCGATCTTCACTGCCGGCTCCTCTCGGGTGTAGATGTCGGGCGTGGTGAGTCTCGGGCAATGCCCTCTCCACTCTCTTGAGTTTGGAGCTTGGGGGAGGGGGGTCCGGTCCTCGTCCGCGGCCTCTTCTCCCTCACGCCTGAATGGGGCTGAGGAGGACTTGGTAGGAGAACGGTAAAGTAGAGAAAAAAGCGGAATGATCTCGGAGGGGCCTAAGGGTGGACCTCGCCGGGGTGAGGTTGGGGGCCAAGGCCGGGGGTGGCCGCGGAGGCGGGCCCCTTGCTCCGGATTTCGGCGTGGGAGGGCGTTTGGGGC
Full Trace Sequence: AAAATGGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAAACAGATTTGCCTTCAGGGTATTGGGCTTTCTATGAAATGTGGAGAGGACACCAGCAAATGGGCCAGGCACTGCGTCGGCTGGTTGCCAGGCTTTGAGGAGCTCAGCTGTGCTGGTGCTGCTGCTACTTGGGACTCCAGGCCAGACTGGGCCCTTGAGGGTCTGCACCGTGTGGGTTGGCACAAGGCCTGAAGCTGCACCAGGGCTGGGGCTCAAGCTTCCCCCAGGGCTATTGAGGTTGCCCGCGGTGGGCAGAGAAGCAGTACTGTCTGGGGTTGGACTGCAGTTGGACTCCTTGGATTCATCGTCTTCTGAAGAGGAACGTCCATCGGACTTCTTATTGCCAGATCCTCCATTGTTGGAACTTCCACCCTTGGAGTTGGTTGCCCTCTCCTGCTTGCGGAACTTGGCCCGTCGATTCTGGAACCAGACCTGGACACGGGCCTCCGTCAGGTCGATCTTCACTGCCGGCTCCTCTCGGGTGTAGATGTCGGGCGTGGTGAGTCTCGGGCAATGCCCTCTCCACTCTCTTGAGTTTGGAGCTTGGGGGAGGGGGGTCCGGTCCTCGTCCGCGGCCTCTTCTCCCTCACGCCTGAATGGGGCTGAGGAGGACTTGGTAGGAGAACGGTAAAGTAGAGAAAAAAGCGGAATGATCTCGGAGGGGCCTAAGGGTGGACCTCGCCGGGGTGAGGTTGGGGGCCAAGGCCGGGGGTGGCCGCGGAGGCGGGCCCCTTGCTCCGGATTTCGGCGTGGGAGGGCGTTTGGGGC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAAACAGATTTGCCTTCAGGGTA