ORFeome > pi4k2a ORF1 – XORFeome v1.0

pi4k2a ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: pi4k2a
Gene ID: 866066
Gene Page ID: 491467
ORF Xenbase ID: 17289159

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC124897
Original XGC clone length: 1410

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11091
Well Location: C12

Sequences - 5ʹ (forward) EST

Accession: JZ838787
dbEST ID: 79656489
Trimmed Sequence: ATGGATGAGACCAGCCCGTTAGTATCTCCGGACCGGGACCAGACCGAATACTCTTATCAGTCTCAGTGCTCTCCCGGAGCCACAGTTCCGCTTAGTCCCAATGGGCGCTTCTCAGCCTTACCGGGGGTAGTAGTTCGAATACCGGGCACGGCTACATCATGCGGATCAGCGGCGTCCGGACCGTCTCCTCCTGGTTCTCCATGTGACCAGGAGAGGCAGCCTCTGCTGGAACGTTCCCAAACCCGAGCAGCGGCAGCCCAGGCCGAAAGAGAAATGAATAAGTTTCCTGATGACCCCGCGTTTGCTGAGGTGGTGAAGAAGGCGGAGAAGGCCATCATGAGGGATATTTTGCCCGAGAGGATCTCCCAGGGATCCAGTGGCGGCTACTTTGTGAAAGATGATCAGGGGGAAATCATCGCTGTCGTTCAACCTAATAATGAAGAACCTTATGGGCAGCTTAACCCCAATTGGACTAAGTGGCTGCTTAAGTTGTGTTTCCCTTTTTGCGTTCGGAAGAGACTGGCGTGTGGCGAATTAAAGATATTGCCCCTGAGTGAGGGGCCAGGCCTAGTTTACGTAAAAGAAATGATAAAAATTGATTCCTGGTACCACAGTTCTTGGTTCGTTCTGTTGGAGAGGTGTATTTTACTATGGGCATGTGTCCGGTGAAAATCTTAAACCAACGTCTCGGCTGGGTGGGGGGAGTTCTGAAAAATTATTTGGAAAAAGTGAGTTGAATTGTGAAGGGGGGTCTCGGGTGTGGTGGTCTGGTCTTGAGATGTTTTTTTATAAGGGCCTGCAGTATATTATCCGGAAGATGTATGTGGGTGGG
Full Trace Sequence: CGCGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGATGAGACCAGCCCGTTAGTATCTCCGGACCGGGACCAGACCGAATACTCTTATCAGTCTCAGTGCTCTCCCGGAGCCACAGTTCCGCTTAGTCCCAATGGGCGCTTCTCAGCCTTACCGGGGGTAGTAGTTCGAATACCGGGCACGGCTACATCATGCGGATCAGCGGCGTCCGGACCGTCTCCTCCTGGTTCTCCATGTGACCAGGAGAGGCAGCCTCTGCTGGAACGTTCCCAAACCCGAGCAGCGGCAGCCCAGGCCGAAAGAGAAATGAATAAGTTTCCTGATGACCCCGCGTTTGCTGAGGTGGTGAAGAAGGCGGAGAAGGCCATCATGAGGGATATTTTGCCCGAGAGGATCTCCCAGGGATCCAGTGGCGGCTACTTTGTGAAAGATGATCAGGGGGAAATCATCGCTGTCGTTCAACCTAATAATGAAGAACCTTATGGGCAGCTTAACCCCAATTGGACTAAGTGGCTGCTTAAGTTGTGTTTCCCTTTTTGCGTTCGGAAGAGACTGGCGTGTGGCGAATTAAAGATATTGCCCCTGAGTGAGGGGCCAGGCCTAGTTTACGTAAAAGAAATGATAAAAATTGATTCCTGGTACCACAGTTCTTGGTTCGTTCTGTTGGAGAGGTGTATTTTACTATGGGCATGTGTCCGGTGAAAATCTTAAACCAACGTCTCGGCTGGGTGGGGGGAGTTCTGAAAAATTATTTGGAAAAAGTGAGTTGAATTGTGAAGGGGGGTCTCGGGTGTGGTGGTCTGGTCTTGAGATGTTTTTTTATAAGGGCCTGCAGTATATTATCCGGAAGATGTATGTGGGTGGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGATGAGACCAGCCCGTT

Sequences - 3ʹ (reverse) EST

Accession: JZ838786
dbEST ID: 79656488
Trimmed Sequence: CCACCAGGAAAAGAAGGGTTTTCTGCTCTGGAAGCTTTGTGTGTAAGATTCACTGGTGCTTTTTTGATGCGACCGTGCAGTTTCTACTATGACTGGCGGGGTCTGGACCAGCTGCAGAGGGCTCTTCCCATCCTTCATAGCCTGTGTCAGGTTAAGGATCTGCCCTCTCATAACTGCTATCTGTTTGCGAAACTGTCCTCTGTCAAATCCTTGATCTTTCTTAAACAGCTCATACAGGTCTTCTTCCAAATCTTTGACAAAATTTGGATCTGAAATCTTTGGAAGAATTAAATCTTTGATTTCTTGGGAAAATTGAATTTTGGCTTGTGGTAACCATGCCCAGTAAAACGGATAGGCTCTCCAGGAGTCAGGATGCTTAAGAGGGAAAGCTAAACCATTGTCGATAGCAGCAATTTTAATCACTGGCTCTTTTACCATGACCCAGTCATCCCGGGCACTTGCACTGTCCATGGGGCAGTCATACTTAATCAACCAGTTATCATTACCTCTGTCTGTATTTCTGATTATGTAGTCCAAAACCACTAATCTCTCAAACTGTAGCTGAAGTTGTCTGTTGGTATTCTCCGGAAGGGGGTCAGCCGTCAATCTCCGAAGCCAATAATCTGCATCTTTTTAGCTTTTTAACAAGATCTGGAAGGAAGCAAGCCTTGGGAAGCAATCCGAGTTCGAATAAATTCCCTTAACCGCTTTTTTGGTCACTTTCCTCCAATGGCCGGGCGGCCTTCCCCCCGGGGAGGTTTTCCCGTGGTCAGTGG
Full Trace Sequence: AAAACTGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACCACCAGGAAAAGAAGGGTTTTCTGCTCTGGAAGCTTTGTGTGTAAGATTCACTGGTGCTTTTTTGATGCGACCGTGCAGTTTCTACTATGACTGGCGGGGTCTGGACCAGCTGCAGAGGGCTCTTCCCATCCTTCATAGCCTGTGTCAGGTTAAGGATCTGCCCTCTCATAACTGCTATCTGTTTGCGAAACTGTCCTCTGTCAAATCCTTGATCTTTCTTAAACAGCTCATACAGGTCTTCTTCCAAATCTTTGACAAAATTTGGATCTGAAATCTTTGGAAGAATTAAATCTTTGATTTCTTGGGAAAATTGAATTTTGGCTTGTGGTAACCATGCCCAGTAAAACGGATAGGCTCTCCAGGAGTCAGGATGCTTAAGAGGGAAAGCTAAACCATTGTCGATAGCAGCAATTTTAATCACTGGCTCTTTTACCATGACCCAGTCATCCCGGGCACTTGCACTGTCCATGGGGCAGTCATACTTAATCAACCAGTTATCATTACCTCTGTCTGTATTTCTGATTATGTAGTCCAAAACCACTAATCTCTCAAACTGTAGCTGAAGTTGTCTGTTGGTATTCTCCGGAAGGGGGTCAGCCGTCAATCTCCGAAGCCAATAATCTGCATCTTTTTAGCTTTTTAACAAGATCTGGAAGGAAGCAAGCCTTGGGAAGCAATCCGAGTTCGAATAAATTCCCTTAACCGCTTTTTTGGTCACTTTCCTCCAATGGCCGGGCGGCCTTCCCCCCGGGGAGGTTTTCCCGTGGTCAGTGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACCACCAGGAAAAGAAGGGTT