ORFeome > pid1 ORF1 – XORFeome v1.0

pid1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: pid1
Gene ID: 960457
Gene Page ID: 960453
ORF Xenbase ID: 17289213

ORF full-length analysis tests

Full-Length confidence: medium
Original XGC clone accession: BC123128
Original XGC clone length: 507

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11087
Well Location: E05

Sequences - 5ʹ (forward) EST

Accession: JZ838048
dbEST ID: 79655750
Trimmed Sequence: ATGTGGCAGCCGGCGAGCGAAAGGCTGCAGGTGACGTATCTGGGGAATGTCTCCACCACCGGAGGTCAGTTTTCTTCAGGATGCACAGAGCAGCCAGTGATTGAATTGTGGAAGAAGCATACCCTTGCCCGGGAAGATGTTTTCCCCTCGAATGCTCTCCTCGAAATCCGCCCCTTCCAGGTACGGCTTCATCACCAGGACCTAAAGGGTGAAGCTACTGTCCACATGGATACTTTCCAAGTGGCGCGCATAGCCTATTGTACAGCCGATCACAACGTGAGCCCCAACATCTTTGCCTGGGTATACAGAGAAATCAACGATGATCTGAGCTTCCAGATGGATTGTCATGCTGTGGAGTGCGAGAGCAAGTTAGAAGCTAAAAAGCTGGCACATGCCATGATGGTGGCATTTAAGAAGACCTTCCAGAGCATGAGGAGTGACGGACGAATCCACAGAGATAGCTCCTCGGAGGAGGTGTCCCAGGGATTCGAGTCTGATGATGGTTT
Full Trace Sequence: TCGCGGGCCATATAATGGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTGGCAGCCGGCGAGCGAAAGGCTGCAGGTGACGTATCTGGGGAATGTCTCCACCACCGGAGGTCAGTTTTCTTCAGGATGCACAGAGCAGCCAGTGATTGAATTGTGGAAGAAGCATACCCTTGCCCGGGAAGATGTTTTCCCCTCGAATGCTCTCCTCGAAATCCGCCCCTTCCAGGTACGGCTTCATCACCAGGACCTAAAGGGTGAAGCTACTGTCCACATGGATACTTTCCAAGTGGCGCGCATAGCCTATTGTACAGCCGATCACAACGTGAGCCCCAACATCTTTGCCTGGGTATACAGAGAAATCAACGATGATCTGAGCTTCCAGATGGATTGTCATGCTGTGGAGTGCGAGAGCAAGTTAGAAGCTAAAAAGCTGGCACATGCCATGATGGTGGCATTTAAGAAGACCTTCCAGAGCATGAGGAGTGACGGACGAATCCACAGAGATAGCTCCTCGGAGGAGGTGTCCCAGGGATTCGAGTCTGATGATGGTTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCATTCAAAATAGAATCATTATTTGCCCTCCACCTGATACCCCTAAAGTGAGTCGTATTTCCTTAAAAAAAAAAAAATAAAAAAAATTTTTATTCCGTTTCTTAAAACGCCGGAAAAAAAAAAACAAAAATCTCCCCCCCCAGGGGGGGGGTGGGGTGTTTTGTGGTTATTGGGGAGAGGGCAACCCCAAGGGAACAAAACCCGGGGCGGGTGCGAAATGTTTGGGGAGAAAAG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTGGCAGCCGGCGAG

Sequences - 3ʹ (reverse) EST

Accession: JZ838047
dbEST ID: 79655749
Trimmed Sequence: ACCATCATCAGACTCGAATCCCTGGGACACCTCCTCCGAGGAGCTATCTCTGTGGATTCGTCCGTCACTCCTCATGCTCTGGAAGGTCTTCTTAAATGCCACCATCATGGCATGTGCCAGCTTTTTAGCTTCTAACTTGCTCTCGCACTCCACAGCATGACAATCCATCTGGAAGCTCAGATCATCGTTGATTTCTCTGTATACCCAGGCAAAGATGTTGGGGCTCACGTTGTGATCGGCTGTACAATAGGCTATGCGCGCCACTTGGAAAGTATCCATGTGGACAGTAGCTTCACCCTTTAGGTCCTGGTGATGAAGCCGTACCTGGAAGGGGCGGATTTCGAGGAGAACATTCGAGGGGAAAACATCTTCCCGGGCAAGGGTATGCTTCTTCCACAATTCAATCACTGGCTGCTCTGTGCATCCTGAAGAAAACTGACCTCCGGTGGTGGAGACGTTCCCCAAATACGTCACCTGCAGGCTTTCGCTCCCCGGCTGGCACATGATGCCGACTGTTTTGTTCGAAGGTTCCAGTTATAAAAAACAATTCTTCTGGGTTTTTTCCGCGGAGCAGGGGCGGGTGCGGTCCNNAAAAAAAAAAAAAAAAAAAAAAAAAAACTTTAATCGGGCTCTTCGGACTGCCAGGCAAAAAAACACCAATGCTCTGTCACCAAGGGGGGCGGGGGATTTAAATGGTTGTAAAGCGAAAAAGAGACACAACCCAAGGAAAAAAAACCGGGGGGGGGGTGTTAATTGTTTTTTGGAAAAAGAA
Full Trace Sequence: AAACCGTCTATTGACGCATGTAATACGACTCACTATANGGGGATATCAGCGTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAACCATCATCAGACTCGAATCCCTGGGACACCTCCTCCGAGGAGCTATCTCTGTGGATTCGTCCGTCACTCCTCATGCTCTGGAAGGTCTTCTTAAATGCCACCATCATGGCATGTGCCAGCTTTTTAGCTTCTAACTTGCTCTCGCACTCCACAGCATGACAATCCATCTGGAAGCTCAGATCATCGTTGATTTCTCTGTATACCCAGGCAAAGATGTTGGGGCTCACGTTGTGATCGGCTGTACAATAGGCTATGCGCGCCACTTGGAAAGTATCCATGTGGACAGTAGCTTCACCCTTTAGGTCCTGGTGATGAAGCCGTACCTGGAAGGGGCGGATTTCGAGGAGAACATTCGAGGGGAAAACATCTTCCCGGGCAAGGGTATGCTTCTTCCACAATTCAATCACTGGCTGCTCTGTGCATCCTGAAGAAAACTGACCTCCGGTGGTGGAGACGTTCCCCAAATACGTCACCTGCAGGCTTTCGCTCCCCGGCTGGCACATGATGCCGACTGTTTTGTTCGAAGGTTCCAGTTATAAAAAACAATTCTTCTGGGTTTTTTCCGCGGAGCAGGGGCGGGTGCGGTCCNNAAAAAAAAAAAAAAAAAAAAAAAAAAACTTTAATCGGGCTCTTCGGACTGCCAGGCAAAAAAACACCAATGCTCTGTCACCAAGGGGGGCGGGGGATTTAAATGGTTGTAAAGCGAAAAAGAGACACAACCCAAGGAAAAAAAACCGGGGGGGGGGTGTTAATTGTTTTTTGGAAAAAGAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAACCATCATCAGACTCGAATCC