ORFeome > pif1 ORF1 – XORFeome v1.0

pif1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: pif1
Gene ID: 5924693
Gene Page ID: 5924612
ORF Xenbase ID: 17289219

ORF full-length analysis tests

Full-Length confidence: low
Original XGC clone accession: BC097805
Original XGC clone length: 1905

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11089
Well Location: E05

Sequences - 5ʹ (forward) EST

Accession: JZ838351
dbEST ID: 79656053
Trimmed Sequence: ATGTTGGCCAAACAGCTGTCTCCAGAAATCCAGAGCAGCATCACTATAGAGTATCTTAATTCTTCTGGGCAGGCTCTGAAGCGCAAAGTAATCCGTAATTCTTTCATCTCCCTTGGACGCAATGAATTCCGCGACCTTGTCTTGAAGGTTAGCGATGGAAAACTTCAACAGAACTTTGTCATAAAGCAGATCCAACTTTTCACCCGTTTTATCCGAGATGGGAAAGCTTCAGTTGTGCTGCTTCCAGAAAATATCCAGCTTTTAATATCGAATTGCCCCGCAGACAAGTTAAAGCACTTTATGAAAACCCTCCTAATTAAACATGAAGCTGGGAAGAAAGAGAAGCCGGTGAATGAACGCACTCGCCTTCTATCTGGGCTGCCACGTATGTTCGAAACCATCAGCCCAGTGCAGAAAAAAGATGTGGAACAGGCTAATGAGATGCGGGCCAAGGCCAACTCTGAGACTCCAGTAAAGGGGAAGGGACTGAGTCACAAAGGAGTGAATGGAGGTAACAGATGCCAGCAAAAACGTACACGCACAGAATCTTCTAACAGCCTAATTGCGGATCTCAGGCCCAGCAAAAAGCCAACACTGTCAATGCCTAAACGGATCCGGCTGTCTACAGAACAATCCCTTGGTGTTGAACACAGTTCTCATTGGGGAAGAACGTCTTCGTCACAGGCAGTGCAGGCACAGGAAAGTCTTATTTATTAAAAAGGATAGGTGGAACTCTCCCAGCC
Full Trace Sequence: CGTGGGCCATATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTTGGCCAAACAGCTGTCTCCAGAAATCCAGAGCAGCATCACTATAGAGTATCTTAATTCTTCTGGGCAGGCTCTGAAGCGCAAAGTAATCCGTAATTCTTTCATCTCCCTTGGACGCAATGAATTCCGCGACCTTGTCTTGAAGGTTAGCGATGGAAAACTTCAACAGAACTTTGTCATAAAGCAGATCCAACTTTTCACCCGTTTTATCCGAGATGGGAAAGCTTCAGTTGTGCTGCTTCCAGAAAATATCCAGCTTTTAATATCGAATTGCCCCGCAGACAAGTTAAAGCACTTTATGAAAACCCTCCTAATTAAACATGAAGCTGGGAAGAAAGAGAAGCCGGTGAATGAACGCACTCGCCTTCTATCTGGGCTGCCACGTATGTTCGAAACCATCAGCCCAGTGCAGAAAAAAGATGTGGAACAGGCTAATGAGATGCGGGCCAAGGCCAACTCTGAGACTCCAGTAAAGGGGAAGGGACTGAGTCACAAAGGAGTGAATGGAGGTAACAGATGCCAGCAAAAACGTACACGCACAGAATCTTCTAACAGCCTAATTGCGGATCTCAGGCCCAGCAAAAAGCCAACACTGTCAATGCCTAAACGGATCCGGCTGTCTACAGAACAATCCCTTGGTGTTGAACACAGTTCTCATTGGGGAAGAACGTCTTCGTCACAGGCAGTGCAGGCACAGGAAAGTCTTATTTATTAAAAAGGATAGGTGGAACTCTCCCAGCC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTTGGCCAAACAGCTGTC

Sequences - 3ʹ (reverse) EST

Accession: JZ838350
dbEST ID: 79656052
Trimmed Sequence: GCAATTTTCTTTGTCCAGGAAGTCATCAAGGGAAGTCTGTCGCAATGCTCTCTCCTTCTGCATTTGATGGTAGAACTGTAGAACATATGGATTGGCTCGAACAACCTTGGGGTCAAAGTCCATAACTCGGAGACCCTCTAGATTTCTAGCTCTGGAGAGAGCAACGTAAGCTTGGCCACTCTCAAAGACACGAGACAATGAGATTTCCACACAGTCCAAAGACATTCCCTGGCTTTTATGGATAGAAATAGCCCATGCCAGCTTTAGAGGCAGCTGCTGTCGGCTCAGATATATTCCACCGTGTCCTTTGAACACCCAGCGGTCAGGCTTTATAACCTCAGTGACACCACACAGAAACCGAACTACTGGCAAGTTTTTGTTGCCTTCTTCAAACTTGATAACGACGCCACGTGCTCCATTCACCAAGCCACGAGACACATCTAGATTCTTTGCCAGCATCACCTGAGCCCCTTTCTTCAGCTGAATCTGCTGATTTACAGGACACTGAGCATTTATAGTTTTCACCAGCATAGGGTCACTGTCCAGAGCCTCATATGAATGGGATTCTCCAGGTAACTGCTGAAGACGACGCTCATTGGTTATTTCCACATCATCTTTGTGAGTGCACAGCCTCGTAGCCCGAAATCCATCTCGCTCAACTTAATGGGTTAGTGGTTTGGAGAAACTTGCCTTGGCGACATCATCTGTAACATCTTGCCAAGTTCG
Full Trace Sequence: GGGAAACTGTCTATGACCATGTAATACGACTCACTATAGGGGAATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGCAATTTTCTTTGTCCAGGAAGTCATCAAGGGAAGTCTGTCGCAATGCTCTCTCCTTCTGCATTTGATGGTAGAACTGTAGAACATATGGATTGGCTCGAACAACCTTGGGGTCAAAGTCCATAACTCGGAGACCCTCTAGATTTCTAGCTCTGGAGAGAGCAACGTAAGCTTGGCCACTCTCAAAGACACGAGACAATGAGATTTCCACACAGTCCAAAGACATTCCCTGGCTTTTATGGATAGAAATAGCCCATGCCAGCTTTAGAGGCAGCTGCTGTCGGCTCAGATATATTCCACCGTGTCCTTTGAACACCCAGCGGTCAGGCTTTATAACCTCAGTGACACCACACAGAAACCGAACTACTGGCAAGTTTTTGTTGCCTTCTTCAAACTTGATAACGACGCCACGTGCTCCATTCACCAAGCCACGAGACACATCTAGATTCTTTGCCAGCATCACCTGAGCCCCTTTCTTCAGCTGAATCTGCTGATTTACAGGACACTGAGCATTTATAGTTTTCACCAGCATAGGGTCACTGTCCAGAGCCTCATATGAATGGGATTCTCCAGGTAACTGCTGAAGACGACGCTCATTGGTTATTTCCACATCATCTTTGTGAGTGCACAGCCTCGTAGCCCGAAATCCATCTCGCTCAACTTAATGGGTTAGTGGTTTGGAGAAACTTGCCTTGGCGACATCATCTGTAACATCTTGCCAAGTTCG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGCAATTTTCTTTGTCCAGGAAGT