ORFeome > pigy ORF1 – XORFeome v1.0

pigy ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: pigy
Gene ID: 6486580
Gene Page ID: 5783231
ORF Xenbase ID: 17289273

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC141740
Original XGC clone length: 363

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11092
Well Location: E04

Sequences - 5ʹ (forward) EST

Accession: JZ838894
dbEST ID: 79656596
Trimmed Sequence: ATGCTGGCTGTCAAGTTATGGAGGAGAACATATAAAACCTTAGTCCAGAGACAACTGAACGCTGCCTGTCCTACCAGCTCACTATCTGCAACCAGACAGCAGCCCCTGCACTGCACTTCAGCTTCCAGAGCCCCAGAACACGATCTGAAGGACAGCAAGGAATTTGATTCCTCCCTCCTGCAATACCTGGTCTGTCCTCTTTCAAGGAAATCTCTGAGATATGAAGAATCTACGAATGAGTTAATGAATGATGAGCTGGGTATAGCTTACCCGATTGTCGATGGCATCCCAAACATGATCCCACAGGATGCCCGCATGATTCAGAAAGATCAGAAGCCTGAGAACACCGAGCAGACAACATT
Full Trace Sequence: GGGGTCTAGCTCGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCTGGCTGTCAAGTTATGGAGGAGAACATATAAAACCTTAGTCCAGAGACAACTGAACGCTGCCTGTCCTACCAGCTCACTATCTGCAACCAGACAGCAGCCCCTGCACTGCACTTCAGCTTCCAGAGCCCCAGAACACGATCTGAAGGACAGCAAGGAATTTGATTCCTCCCTCCTGCAATACCTGGTCTGTCCTCTTTCAAGGAAATCTCTGAGATATGAAGAATCTACGAATGAGTTAATGAATGATGAGCTGGGTATAGCTTACCCGATTGTCGATGGCATCCCAAACATGATCCCACAGGATGCCCGCATGATTCAGAAAGATCAGAAGCCTGAGAACACCGAGCAGACAACATTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAACTCTAGCCCGAGTCTCAAAATCCTTGATGTTACAAGGCGGCGGGGGCGTTTTGCTCCCGTTCGCCTTCTCCCGGGTTTGGGGGAAAAAAATACCCTGATTTTTTGAATGACCCCACCCGGCGGAAACAAAACCCCGCCGATAAAAATTAAAACGTAAAGACTACCGCCCCAAGAGGAGGGGTCCAGAACGTGGACAAACAAACAGGGGGAAGGGAGGGAGTGGGGGTTGTCTGTCTCTTTTCTTAATTG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCTGGCTGTCAAGTTATGG

Sequences - 3ʹ (reverse) EST

Accession: JZ838893
dbEST ID: 79656595
Trimmed Sequence: TGTTGTCTGCTCGGTGTTCTCAGGCTTCTGATCTTTCTGAATCATGCGGGCATCCTGTGGGATCATGTTTGGGATGCCATCGACAATCGGGTAAGCTATACCCAGCTCATCATTCATTAACTCATTCGTAGATTCTTCATATCTCAGAGATTTCCTTGAAAGAGGACAGACCAGGTATTGCAGGAGGGAGGAATCAAATTCCTTGCTGTCCTTCAGATCGTGTTCTGGGGCTCTGGAAGCTGAAGTGCAGTGCAGGGGCTGCTGTCTGGTTGCAGATAGTGAGCTGGTAGGACAGGCAGCGTTCAGTTGTCTCTGGACTAAGGTTTTATATGTTCTCCTCCATAACTTGACAGCCAGCATGG
Full Trace Sequence: AAAGGTCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATGTTGTCTGCTCGGTGTTCTCAGGCTTCTGATCTTTCTGAATCATGCGGGCATCCTGTGGGATCATGTTTGGGATGCCATCGACAATCGGGTAAGCTATACCCAGCTCATCATTCATTAACTCATTCGTAGATTCTTCATATCTCAGAGATTTCCTTGAAAGAGGACAGACCAGGTATTGCAGGAGGGAGGAATCAAATTCCTTGCTGTCCTTCAGATCGTGTTCTGGGGCTCTGGAAGCTGAAGTGCAGTGCAGGGGCTGCTGTCTGGTTGCAGATAGTGAGCTGGTAGGACAGGCAGCGTTCAGTTGTCTCTGGACTAAGGTTTTATATGTTCTCCTCCATAACTTGACAGCCAGCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGGGGCCAAAAAAAAAAAATATACAACATTTTATAACTCCTCAACTGAGAATGCGGGGAAAATGTCTCAAAAAGGCGCTCCCGAAAGGTGGCGGGTGAATTATCTTGTTATTTGGCGGTGGCCGAACCCCGGGGACAAAAAACCTTCCGGGCGCGATTTAATACTATGAAAAACCCCCCTCGGACGCGGCCCCAAACCTTGCCCAAACCTTTTTTTTAAAAGCGGTGGGGGGGGTTTTCGGGGATCCTGAAACGGGGTTTTTTTGAGGGAAAAAAAAAAAACCGCCGAGCGCGACGGAGAAAAGGAGATT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATGTTGTCTGCTCGGTGTT