ORFeome > pin1 ORF2 – XORFeome v1.0

pin1 ORF2 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: pin1
Gene ID: 856265
Gene Page ID: 856253
ORF Xenbase ID: 17289321

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC106673
Original XGC clone length: 480

Human orthology & disease relationships

NCBI Entrez ID: 5300
Ensembl gene IDs: ENSG00000127445
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 114480,133239,136680,137357,151623,182290,194070,194080,209950,211980,256370,260500,262650,275355,609135

Library Location

Plate ID: GDExl11083
Well Location: B03

Sequences - 5ʹ (forward) EST

Accession: JZ837269
dbEST ID: 79654971
Trimmed Sequence: ATGGCGGACGAGGAAAAGCTACCGCCCGGGTGGGAGAAGCGCATGAACCCAAACCTCTGGACGTGTGTATTATTTCAATCACATGACTAATGCCAGCCAATGGGAAAGGCCCACTGCAGGTGGGAAAAATGGCCAAGGGGACCCTGGTAAAGTGCGATGTTCTCATCTACTTGTGAAACACAATCAGTCGCGGCGTCCTTCATCATGGAGACAGGACAACATCACACGCACCAAGGACGAGGCCCTGGAACTCATTAATGGCTACATCCAGAAGATAAAATCGGGGGATGAGGATTTTGAATCTCTGGCTTCTCAGTTCAGTGACTGCAGCTCAGCTAAGGCCGGAGGTGATCTGGGCAGCTTTGGGAAAGGCGCAATGCAGAAGCCCTTCGAAGATGCTTCTTTCGCTCTGAGGCCTGGAGAGATGAGTGGCCCCGTCTTCACAGAGTCCGGCATTCACATTATCCTCCGCACTGAGTT
Full Trace Sequence: GAGGGCCATATAATAGATTTTANTTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCGGACGAGGAAAAGCTACCGCCCGGGTGGGAGAAGCGCATGAACCCAAACCTCTGGACGTGTGTATTATTTCAATCACATGACTAATGCCAGCCAATGGGAAAGGCCCACTGCAGGTGGGAAAAATGGCCAAGGGGACCCTGGTAAAGTGCGATGTTCTCATCTACTTGTGAAACACAATCAGTCGCGGCGTCCTTCATCATGGAGACAGGACAACATCACACGCACCAAGGACGAGGCCCTGGAACTCATTAATGGCTACATCCAGAAGATAAAATCGGGGGATGAGGATTTTGAATCTCTGGCTTCTCAGTTCAGTGACTGCAGCTCAGCTAAGGCCGGAGGTGATCTGGGCAGCTTTGGGAAAGGCGCAATGCAGAAGCCCTTCGAAGATGCTTCTTTCGCTCTGAGGCCTGGAGAGATGAGTGGCCCCGTCTTCACAGAGTCCGGCATTCACATTATCCTCCGCACTGAGTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAGAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTTATATCCCTCGATATTGAGTTCAAATTAAAAAAAAAAAAAAAAATAAAAAAAAAACTCTGACCCGTGTCTCCATCCGAAAACCCCCCGGAAAAAAAAGCCCAAAACGCCCCCCCTACCAAGGGGGCCCTGGTGTATCACCCCTGTTGGAAAGGGAAAGAAGGCCCCAACCCATGGAAAAAAAACCCCGGTGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGGACGAGGAAAAG

Sequences - 3ʹ (reverse) EST

Accession: JZ837268
dbEST ID: 79654970
Trimmed Sequence: CTCAGTGCGGAGGATAATGTGAATGCCGGACTCTGTGAAGACGGGGCCACTCATCTCTCCAGGCCTCAGAGCGAAAGAAGCATCTTCGAAGGGCTTCTGCATTGCGCCTTTCCCAAAGCTGCCCAGATCACCTCCGGCCTTAGCTGAGCTGCAGTCACTGAACTGAGAAGCCAGAGATTCAAAATCCTCATCCCCCGATTTTATCTTCTGGATGTAGCCNTTAATGAGTTCCAGGGCCTCGTCCTTGGTGCGTGTGATGTTGTCCTGTCTCCATGATGAAGGACGCCGCGACTGATTGTGTTTCACAAGTAGATGAGAACATCGCACTTTACCAGGGTCCCCTTGGCCATTTTTCCCACCTGCAGTGGGCCTTTCCCATTGGCTGGCATTAGTCATGTGATTGAAATAATAACACCCTCCAGAGCTTCGGCTCATGCGCTTCTCCCACCCGGGCGGTAGCTTTTCCTCGTCCGCCCTTGG
Full Trace Sequence: GGCACTCGGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACTCAGTGCGGAGGATAATGTGAATGCCGGACTCTGTGAAGACGGGGCCACTCATCTCTCCAGGCCTCAGAGCGAAAGAAGCATCTTCGAAGGGCTTCTGCATTGCGCCTTTCCCAAAGCTGCCCAGATCACCTCCGGCCTTAGCTGAGCTGCAGTCACTGAACTGAGAAGCCAGAGATTCAAAATCCTCATCCCCCGATTTTATCTTCTGGATGTAGCCNTTAATGAGTTCCAGGGCCTCGTCCTTGGTGCGTGTGATGTTGTCCTGTCTCCATGATGAAGGACGCCGCGACTGATTGTGTTTCACAAGTAGATGAGAACATCGCACTTTACCAGGGTCCCCTTGGCCATTTTTCCCACCTGCAGTGGGCCTTTCCCATTGGCTGGCATTAGTCATGTGATTGAAATAATAACACCCTCCAGAGCTTCGGCTCATGCGCTTCTCCCACCCGGGCGGTAGCTTTTCCTCGTCCGCCCTTGGTGCCAACTTTTTTGGTCAAAAGTGGCATTATAAGAAAACATTTGCGCATCATTTTGTTGCAACCAACAGGTCACTATCAAGTCAAGTAAAAATCATTAAAAGAAAAAAAAAAAATAAAGCTGATACTAACCCAGGCATCACGAAACCCCGGGGGGACAAAAAGCCCCAACCTTCCTTCCCTAACAAAGGGT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACTCAGTGCGGAGGATAATGT