ORFeome > pip4k2a ORF1 – XORFeome v1.0

pip4k2a ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: pip4k2a
Gene ID: 6078396
Gene Page ID: 979373
ORF Xenbase ID: 17289339

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC129059
Original XGC clone length: 1248

Human orthology & disease relationships

NCBI Entrez ID: 5305
Ensembl gene IDs: ENSG00000150867
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 114480,114500,121850,125853,137800,153480,158350,176807,176920,276950,300555,309000,600652,603278,604370,607841,608089

Library Location

Plate ID: GDExl11083
Well Location: C11

Sequences - 5ʹ (forward) EST

Accession: JZ837417
dbEST ID: 79655119
Trimmed Sequence: ATGGCCTCGAACGGCGGCGGCGGCGGCGGAGGCGCAATTTCCATCATTGGCAGCGCCAGTAAAACTAAAACCAAGAAGAAACATTTCGTGTGTCAGAAAGTGAAGTTGTTCCGCGCCAGTGAGCCGCTCCTCAGTGTCCTCATGTGGGGGGTCAACCATACGGTCAATGAGTTGAGCAATGTCCCCGCTCCTGTCATGCTGATGCCGGATGACTTTAAAGCCTACAGTAAAATTAAAGTGGACAATCACCTTTTCAACAAGGAGAACCTGCCAAGCCGTTTCAAGTTCAAGGAGTACTGCCCCATGGTCTTCCGAAACCTGCGAGAGAGGTTTGGAATCGATGATCAGGATTACCAGAACTCATTGACCCGCAGCGCTCCAGTAAACAGCGAGAATCAAGGGCGGTTTGGCTCGCGTTTCCTCACCACTTACGATCGTCGGTTCGTCATTAAAACAATATCCAGCGAGGATGTGGCAGAGATGCACAATATCCTAAAGAAATACCACCAGTTTATAGTGGAGTGCCATGGAAATACTCTGCTGCCTCAGTTTCTGGGGATGTACAGACTCACTGTGGGATGGAGTGGAGACCTACATGATTGTCACCAGAAATGTATTCAGTCATCGACTTGGGGTTCATCGCAAGTACGACCCTGAAGGGCTCCACAGTGTCTAGAAGAACCAGCGGGCAAAAAAAAGGCAAGGACCTGCCTACCTTTAAAAAATACAATTTTTCTAAACAAGGGGCAAAAACTGCACCCTTTTGGGAAAAAAAAAAAAAAAAAATTTCCCGGGAAAAATTTAAACCCCAAGAAATTT
Full Trace Sequence: CGGGGGCCCACATAATAGATTTTATTTTNGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCCTCGAACGGCGGCGGCGGCGGCGGAGGCGCAATTTCCATCATTGGCAGCGCCAGTAAAACTAAAACCAAGAAGAAACATTTCGTGTGTCAGAAAGTGAAGTTGTTCCGCGCCAGTGAGCCGCTCCTCAGTGTCCTCATGTGGGGGGTCAACCATACGGTCAATGAGTTGAGCAATGTCCCCGCTCCTGTCATGCTGATGCCGGATGACTTTAAAGCCTACAGTAAAATTAAAGTGGACAATCACCTTTTCAACAAGGAGAACCTGCCAAGCCGTTTCAAGTTCAAGGAGTACTGCCCCATGGTCTTCCGAAACCTGCGAGAGAGGTTTGGAATCGATGATCAGGATTACCAGAACTCATTGACCCGCAGCGCTCCAGTAAACAGCGAGAATCAAGGGCGGTTTGGCTCGCGTTTCCTCACCACTTACGATCGTCGGTTCGTCATTAAAACAATATCCAGCGAGGATGTGGCAGAGATGCACAATATCCTAAAGAAATACCACCAGTTTATAGTGGAGTGCCATGGAAATACTCTGCTGCCTCAGTTTCTGGGGATGTACAGACTCACTGTGGGATGGAGTGGAGACCTACATGATTGTCACCAGAAATGTATTCAGTCATCGACTTGGGGTTCATCGCAAGTACGACCCTGAAGGGCTCCACAGTGTCTAGAAGAACCAGCGGGCAAAAAAAAGGCAAGGACCTGCCTACCTTTAAAAAATACAATTTTTCTAAACAAGGGGCAAAAACTGCACCCTTTTGGGAAAAAAAAAAAAAAAAAATTTCCCGGGAAAAATTTAAACCCCAAGAAATTT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCCTCGAACGGCGG

Sequences - 3ʹ (reverse) EST

Accession: JZ837416
dbEST ID: 79655118
Trimmed Sequence: CATGAGGATGTTGGACATAAACTCGATGAAGCGTTTGGAATACTGCTCCGGATTCACCGTGGAGATTTCTGCTCCAGCCCCGTGCTTTACAGTTTTGGCGGCGTGTGCAGCTTTCTTCTTGGCATCGTAGGGAGTAAGAATGTCTATAATGGCCATGAAATACACTTCCTTCTTGGGAGCATTGTCATGGCTCTTCATCGCATACACATCCACGGACGGGTCAAACTCTCCAGGTCCAAAGAACCGTGGAAAGTTGAGAAGATTTCCAGGACTGTCCGGGGGGGTTCCGTAGGAGCAGATGGGGTTCCCTGAGCCGTCCTCACACTCCTCCTCTTCTGCCCTCTCTTCCACCTCCATCTCTTCTTGCTCTGCCCGGTCCACATCATGCAGCCCAACTAACAGGCTGTAATCCATTATCTTCAGCACAGACAAAAACTCCACATCTCGCTTTAACTTCTCCAGGAACATCTTCTTGTTCTCCTCCCCAACGTGCAGCTTCTGCCCCTCGTTCAGAAAATCATTATCTTTAAACGTAAGCGGGTCGCTGGCCTTTTCTTTGCCTCTGGCGTCTCTAGACACTGTGGAAGCCCTTCAGGTCGTACTTGCGAAGAACCCCCAGGTCCATGACTGAATACCTTTTCTGGTAACAATCCGGTAAGGCCTCCGGTCCTTCCCCCATTCAGTCTTTTACCTTCCCCCGAACCTTAAACCCCACAAAAAAATTTCCCATGGACAGTCCCACTATAAAACCTGCTCTTGAATTTTTCTTTTGGGAA
Full Trace Sequence: AAAACGGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACATGAGGATGTTGGACATAAACTCGATGAAGCGTTTGGAATACTGCTCCGGATTCACCGTGGAGATTTCTGCTCCAGCCCCGTGCTTTACAGTTTTGGCGGCGTGTGCAGCTTTCTTCTTGGCATCGTAGGGAGTAAGAATGTCTATAATGGCCATGAAATACACTTCCTTCTTGGGAGCATTGTCATGGCTCTTCATCGCATACACATCCACGGACGGGTCAAACTCTCCAGGTCCAAAGAACCGTGGAAAGTTGAGAAGATTTCCAGGACTGTCCGGGGGGGTTCCGTAGGAGCAGATGGGGTTCCCTGAGCCGTCCTCACACTCCTCCTCTTCTGCCCTCTCTTCCACCTCCATCTCTTCTTGCTCTGCCCGGTCCACATCATGCAGCCCAACTAACAGGCTGTAATCCATTATCTTCAGCACAGACAAAAACTCCACATCTCGCTTTAACTTCTCCAGGAACATCTTCTTGTTCTCCTCCCCAACGTGCAGCTTCTGCCCCTCGTTCAGAAAATCATTATCTTTAAACGTAAGCGGGTCGCTGGCCTTTTCTTTGCCTCTGGCGTCTCTAGACACTGTGGAAGCCCTTCAGGTCGTACTTGCGAAGAACCCCCAGGTCCATGACTGAATACCTTTTCTGGTAACAATCCGGTAAGGCCTCCGGTCCTTCCCCCATTCAGTCTTTTACCTTCCCCCGAACCTTAAACCCCACAAAAAAATTTCCCATGGACAGTCCCACTATAAAACCTGCTCTTGAATTTTTCTTTTGGGAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACATGAGGATGTTGGACATAAACT