ORFeome > pkdcc.1 ORF1 – XORFeome v1.0

pkdcc.1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: pkdcc.1
Gene ID: 6079362
Gene Page ID: 5993400
ORF Xenbase ID: 17289423

ORF full-length analysis tests

Full-Length confidence: low
Original XGC clone accession: BC130129
Original XGC clone length: 1131

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11090
Well Location: B02

Sequences - 5ʹ (forward) EST

Accession: JZ838559
dbEST ID: 79656261
Trimmed Sequence: ATGGGTCGGACAGGGACTTTATTAGGCTGCGAGGATCTCACGTATGTAACTGGCCTCCAGTACGTGGGCTCCGGATTCACTAAACTTGTTCACAAGGGAACTTTGCGCAACGGGAAGGAGATCGCTCTCAAGTCTGTGCACAATGAGGGCAACGATGTGACTCGCTGCGTCAGACGCTACGGCGACCCCGCTGGCTGCCGCTCTCTCGCCACTTACAAACTCCACAAGGAGGTCACTCTGCTCCGGACCTTGCGCCACCCGGGCGTCATTACGTTGCATGGACATTGCTACGAGAATAGCCTGGCTCCTAACTTTAGGGTCACAGCTATGCTGGAACTGGGATCTCCCCTAGAGATGATTCAGCTTCTGCAGACCCCCTGGGAGAAGAGATTTAAAATTTGCCTAGAACTGGTAAATTTACTGCATTATCTAGCCAACTCTCCCATGGGATCTATTGCCCTCCTGGATTTTCAGCCAAGGCAGTTTGTCCTGGTTGATGAAAACCTGAAAGTAACAGATATAGATGATGCCACAATGGAGGAGCTTGAGTGCAACACGGACAAGGATTGTACTCTTGAATTTCCATCCAGGACATTTGCTGTCAGGTGCTCCCGTGCTGGGAGATGCACTGGCATCAATGAAAAAAGGAACCTCTTCAATGCATACAGGGTTTTTCTTCACATATCTGCTTCCCCCACCCACCCCCTCCTGCTTTGCAACCCTCTTCTCTTGGAACATTAATAAATGCCCCAGGGGGAACCTTGAACCTTGTGGCATTTAATGTAAAACCCCCTGGAAACCCTTTTTCCCA
Full Trace Sequence: CGAGGGCCCAATAATGGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGGTCGGACAGGGACTTTATTAGGCTGCGAGGATCTCACGTATGTAACTGGCCTCCAGTACGTGGGCTCCGGATTCACTAAACTTGTTCACAAGGGAACTTTGCGCAACGGGAAGGAGATCGCTCTCAAGTCTGTGCACAATGAGGGCAACGATGTGACTCGCTGCGTCAGACGCTACGGCGACCCCGCTGGCTGCCGCTCTCTCGCCACTTACAAACTCCACAAGGAGGTCACTCTGCTCCGGACCTTGCGCCACCCGGGCGTCATTACGTTGCATGGACATTGCTACGAGAATAGCCTGGCTCCTAACTTTAGGGTCACAGCTATGCTGGAACTGGGATCTCCCCTAGAGATGATTCAGCTTCTGCAGACCCCCTGGGAGAAGAGATTTAAAATTTGCCTAGAACTGGTAAATTTACTGCATTATCTAGCCAACTCTCCCATGGGATCTATTGCCCTCCTGGATTTTCAGCCAAGGCAGTTTGTCCTGGTTGATGAAAACCTGAAAGTAACAGATATAGATGATGCCACAATGGAGGAGCTTGAGTGCAACACGGACAAGGATTGTACTCTTGAATTTCCATCCAGGACATTTGCTGTCAGGTGCTCCCGTGCTGGGAGATGCACTGGCATCAATGAAAAAAGGAACCTCTTCAATGCATACAGGGTTTTTCTTCACATATCTGCTTCCCCCACCCACCCCCTCCTGCTTTGCAACCCTCTTCTCTTGGAACATTAATAAATGCCCCAGGGGGAACCTTGAACCTTGTGGCATTTAATGTAAAACCCCCTGGAAACCCTTTTTCCCA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGGTCGGACAGGGACTT

Sequences - 3ʹ (reverse) EST

Accession: JZ838558
dbEST ID: 79656260
Trimmed Sequence: CTTTTTGAGGTTGCTTGGTTTTTTCATGTAAACACGGGAATTCGCATCAGGGATAAGTTTGTGGGCACTACTGGTGAATGTTGCCATCAGGCGGCCTGTCCATGTTCTTTGATGACCAATGACAAAGTGGTGACAGTTTGGATTCTTGCTACAGAACTCGGCAGCCTCTTCTGAATTGTGCACAGACAGCGCGCACCCTCTGTGATTGTAGGAGGGCCAACATCTGAAGTCGTCATTGGTTTCATTTAGTCTGTATCCTTCTATCAGCATGTAGTCTTTCAAATATAGCAGCCTCCTCTGATGGTTCATTCCCGATTTGTACAGCTTCAAAACATTCTGGAAAGCTTCCAGGGTCTCATTAATGCCATAGCTCAAGTCCCCTGTGGCATTCATAATGTCCAAGAGAAGAGGCTGCAAAGCAGGAGGCGCTGCGTGCGGGAGCAGATATGTGAAGAAAAACCTGTATGCATTGAAGAGGTTCCTTTTTTCATTGATGCCAGTGCATCTCCCAGCACGGGAGCACCTGACAGCAAATGTCCTGGATGGAAATTCAAGAGTACAATCCCTTGTCCGTGTTGCACTCAAGCTCCTCCATTGTGGCATCATCTATATCTGTTTACTTTCAGGGTTTCATCAACCAGGACAAACTGGCCTTGGCTGAAAAATCCAGGGGGGGCAATAGATTCCCATGGGGAAAAATTGGGCTAAAATAAGGCAGGTAAATTTTAACAAGTTTTCAAGGCCAAATTTTTAAATCTCTTTTCCTCC
Full Trace Sequence: GGAAAAAGGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACTTTTTGAGGTTGCTTGGTTTTTTCATGTAAACACGGGAATTCGCATCAGGGATAAGTTTGTGGGCACTACTGGTGAATGTTGCCATCAGGCGGCCTGTCCATGTTCTTTGATGACCAATGACAAAGTGGTGACAGTTTGGATTCTTGCTACAGAACTCGGCAGCCTCTTCTGAATTGTGCACAGACAGCGCGCACCCTCTGTGATTGTAGGAGGGCCAACATCTGAAGTCGTCATTGGTTTCATTTAGTCTGTATCCTTCTATCAGCATGTAGTCTTTCAAATATAGCAGCCTCCTCTGATGGTTCATTCCCGATTTGTACAGCTTCAAAACATTCTGGAAAGCTTCCAGGGTCTCATTAATGCCATAGCTCAAGTCCCCTGTGGCATTCATAATGTCCAAGAGAAGAGGCTGCAAAGCAGGAGGCGCTGCGTGCGGGAGCAGATATGTGAAGAAAAACCTGTATGCATTGAAGAGGTTCCTTTTTTCATTGATGCCAGTGCATCTCCCAGCACGGGAGCACCTGACAGCAAATGTCCTGGATGGAAATTCAAGAGTACAATCCCTTGTCCGTGTTGCACTCAAGCTCCTCCATTGTGGCATCATCTATATCTGTTTACTTTCAGGGTTTCATCAACCAGGACAAACTGGCCTTGGCTGAAAAATCCAGGGGGGGCAATAGATTCCCATGGGGAAAAATTGGGCTAAAATAAGGCAGGTAAATTTTAACAAGTTTTCAAGGCCAAATTTTTAAATCTCTTTTCCTCC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACTTTTTGAGGTTGCTTGGTTTTTT