ORFeome > pld3 ORF1 – XORFeome v1.0

pld3 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: pld3
Gene ID: 1006830
Gene Page ID: 1006823
ORF Xenbase ID: 17289507

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC059981
Original XGC clone length: 1482

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11018
Well Location: A02

Sequences - 5ʹ (forward) EST

Accession: JZ824496
dbEST ID: 79642198
Trimmed Sequence: ATGGTTCCAAAGTGGAGTACAAACCAATACAGCCTCATGAAGAAGCAGAAAATCATTTTCTCCAGCATGAGCTTCACAAAGTAAAAGCTCGCAAGTACTACCGATGCGCACTTGGCGTCGCAATTATTATCACCCTCGTGTTCTGTATCTTGGCTTCTCAGCTCCTTCTCTTTCCCTTTTTGTCCATTACTTCTCAAACAACTGAGACAGTGCTGAACAAGGACATCCGATGTGATGATCAATGGAGGTTTGTTCTGGTAGAGAGCATCCCTGAGGGATTGGTGTATGACGCCCACTCTACGATAAATCCGTCAATTTTCCAGTCCTGGATGAACATTATTACTAATGGTAAAAGCAGCATTGACATTGCGTCCTTTTACTGGTCTCTGACCAACGAGGACACACAAACTAAGGAGCCCTCAGCACATCAGGGAGAATTGATCCTTCAAGAGCTTCTGAATCTAAAGCAGAGGGGAGTGTCATTAAGAGTTGCTGTCAACCCTCCAGACTCCCCCATAAGGTCCAAAGACATTTCTGCTCTAAAAGACAGGGGAGCAGATGTACGTGTGGTAGACATGCCAAAGCTGACAGATGGCATTCTGCATACTAAANTTTTGGGTTGTTGACAATGAACATTTCTACATTGGTAGTGCTAATATGGGACTGGAGATCTCCTACACAGGTGAAAGGAACTTGGTGCCACATATAATAACTGCAGCTGCCCTAGCCCAGATTTTGAAAAAATCCTTTGAGCCGTATGGGAATCTTTGGGGGTACCCCAAGGCAACTTTTG
Full Trace Sequence: AATCGATTTTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGTTCCAAAGTGGAGTACAAACCAATACAGCCTCATGAAGAAGCAGAAAATCATTTTCTCCAGCATGAGCTTCACAAAGTAAAAGCTCGCAAGTACTACCGATGCGCACTTGGCGTCGCAATTATTATCACCCTCGTGTTCTGTATCTTGGCTTCTCAGCTCCTTCTCTTTCCCTTTTTGTCCATTACTTCTCAAACAACTGAGACAGTGCTGAACAAGGACATCCGATGTGATGATCAATGGAGGTTTGTTCTGGTAGAGAGCATCCCTGAGGGATTGGTGTATGACGCCCACTCTACGATAAATCCGTCAATTTTCCAGTCCTGGATGAACATTATTACTAATGGTAAAAGCAGCATTGACATTGCGTCCTTTTACTGGTCTCTGACCAACGAGGACACACAAACTAAGGAGCCCTCAGCACATCAGGGAGAATTGATCCTTCAAGAGCTTCTGAATCTAAAGCAGAGGGGAGTGTCATTAAGAGTTGCTGTCAACCCTCCAGACTCCCCCATAAGGTCCAAAGACATTTCTGCTCTAAAAGACAGGGGAGCAGATGTACGTGTGGTAGACATGCCAAAGCTGACAGATGGCATTCTGCATACTAAANTTTTGGGTTGTTGACAATGAACATTTCTACATTGGTAGTGCTAATATGGGACTGGAGATCTCCTACACAGGTGAAAGGAACTTGGTGCCACATATAATAACTGCAGCTGCCCTAGCCCAGATTTTGAAAAAATCCTTTGAGCCGTATGGGAATCTTTGGGGGTACCCCAAGGCAACTTTTG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAGTTCCAAAGTGGAGTACAA

Sequences - 3ʹ (reverse) EST

Accession: JZ829849
dbEST ID: 79647551
Trimmed Sequence: AAAGATACACTTTTCCTTCCATGAACTTAAAGTGTTAAATGTCAGGCTGTAATTTGAATTCCAGTCTCTTTCAAACACAGTTTGTAGTTGCATTTGGATAGTGTCTGAAGTGCCAGCAGACTGTGTCTGGTTCACTACCAATGCTGAGCCGGCTGTATTTATGAAATAGTCCCCAGACCAGTTAGATGTACCAATATAAGCCACTCTGTCTGTCACCATGTACTTATTGTGATTCACTCTGGCATATGGGATCTTCTTTTGTGCCTCAGTTGCTGGGACCACAAATATTTTCACTTCAATGTTGTAATGGCTTGTGTTACTATGCAAAGCAGCCAGGGATCTAAGGAAGGTGAACATGGAAGGTCGAGAGTTTTTCCAGCAGCTGATCAACAAGCGGACATTAACATTCCTTTCATAGACGGCTTTCCTCAAATGGTTGTCAATTTCAGGCCAGTATCTCCTGGGATGGGAGAATTCCTCTGTGGGTGAGTAATCCATGACAGAAATATATACAAATTTCTTGGCATCGTCTATAATGTTCATAATGGACTGGAGATCATCAGTTCTCCCAGTTGCTGAAAGAGGGGGTGGTGAGCTTGAAAGATAAACCTGAGATGCTGTGCTGTTCAGCATTACTTGCATTGGTGTATCTTTATTGTATGGTGGTCGATAATTAACCCGCGCATGGGGGATGGCAAAATTTGCATTGGGGAAACCCAAGGGATCCAAAACCCCTTCCAAAAAATTTTTCTCCCAAACCTTGG
Full Trace Sequence: CTGGCAGGAAACAGCTATGACCATGTAATACGACTCACTATAGGGGAATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAAAGATACACTTTTCCTTCCATGAACTTAAAGTGTTAAATGTCAGGCTGTAATTTGAATTCCAGTCTCTTTCAAACACAGTTTGTAGTTGCATTTGGATAGTGTCTGAAGTGCCAGCAGACTGTGTCTGGTTCACTACCAATGCTGAGCCGGCTGTATTTATGAAATAGTCCCCAGACCAGTTAGATGTACCAATATAAGCCACTCTGTCTGTCACCATGTACTTATTGTGATTCACTCTGGCATATGGGATCTTCTTTTGTGCCTCAGTTGCTGGGACCACAAATATTTTCACTTCAATGTTGTAATGGCTTGTGTTACTATGCAAAGCAGCCAGGGATCTAAGGAAGGTGAACATGGAAGGTCGAGAGTTTTTCCAGCAGCTGATCAACAAGCGGACATTAACATTCCTTTCATAGACGGCTTTCCTCAAATGGTTGTCAATTTCAGGCCAGTATCTCCTGGGATGGGAGAATTCCTCTGTGGGTGAGTAATCCATGACAGAAATATATACAAATTTCTTGGCATCGTCTATAATGTTCATAATGGACTGGAGATCATCAGTTCTCCCAGTTGCTGAAAGAGGGGGTGGTGAGCTTGAAAGATAAACCTGAGATGCTGTGCTGTTCAGCATTACTTGCATTGGTGTATCTTTATTGTATGGTGGTCGATAATTAACCCGCGCATGGGGGATGGCAAAATTTGCATTGGGGAAACCCAAGGGATCCAAAACCCCTTCCAAAAAATTTTTCTCCCAAACCTTGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAAAGATACACTTTTCCTTCCATGA