ORFeome > pld6 ORF1 – XORFeome v1.0

pld6 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: pld6
Gene ID: 5729953
Gene Page ID: 5729936
ORF Xenbase ID: 17289513

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC128979
Original XGC clone length: 633

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11084
Well Location: F10

Sequences - 5ʹ (forward) EST

Accession: JZ837633
dbEST ID: 79655335
Trimmed Sequence: ATGTTACTGTGGGGGCGCTGGAAGTTAGCCGCGGGCCTGGCGGGCCTTGCTCTCAGCCTAGAGCTGTTCTATCGGTACATGAGGCGGAGAAAGCCTCTTCGGGAGGTGCTGTTTTTCCCGGTTCCGGTGACCTGTATCGAGCCCGTGTTGTCTCCCATGAAGCAATGCTCCTGTCCACTCCCTCACACCGACAGCGCCTTCAGCCGTCTCCTCGTGCAGCTCCTCGGGGCCCAGCGCAGCCTGGAACTCTGTGTATTCACCTTCTCCAGTCCCTCCCTGGCCCGGGCCTTGCTTATTCTGCACCGCAGGGACGTCAGGGTCCGAGTCATCACTGACAACGACTACATGGCTGCCCCCGGCTCTCAGATTGGGCCCCTGCGGAGCGCAGGTGTTGCAGTTCGACATGACCAGTCCAGTGGCTATATGCACCACAAGTTTGCTGTTGTTGACGGGACAGTTGTTCTGACCGGCTCCCTAAACTGGACCGTCCAAGCATTCCAGTCCAACAAGGAGAACATTCTCATTACAGATGACACTGTGATTGTAAAAGCTTATCAAAAGGAGTTTGAGCGACTCTGGGAAGAGTATGATCAAGCAACTTATAATTTCCTTCCTGAAAAGGAAAGAAATTT
Full Trace Sequence: TCGAGGGCCCAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTTACTGTGGGGGCGCTGGAAGTTAGCCGCGGGCCTGGCGGGCCTTGCTCTCAGCCTAGAGCTGTTCTATCGGTACATGAGGCGGAGAAAGCCTCTTCGGGAGGTGCTGTTTTTCCCGGTTCCGGTGACCTGTATCGAGCCCGTGTTGTCTCCCATGAAGCAATGCTCCTGTCCACTCCCTCACACCGACAGCGCCTTCAGCCGTCTCCTCGTGCAGCTCCTCGGGGCCCAGCGCAGCCTGGAACTCTGTGTATTCACCTTCTCCAGTCCCTCCCTGGCCCGGGCCTTGCTTATTCTGCACCGCAGGGACGTCAGGGTCCGAGTCATCACTGACAACGACTACATGGCTGCCCCCGGCTCTCAGATTGGGCCCCTGCGGAGCGCAGGTGTTGCAGTTCGACATGACCAGTCCAGTGGCTATATGCACCACAAGTTTGCTGTTGTTGACGGGACAGTTGTTCTGACCGGCTCCCTAAACTGGACCGTCCAAGCATTCCAGTCCAACAAGGAGAACATTCTCATTACAGATGACACTGTGATTGTAAAAGCTTATCAAAAGGAGTTTGAGCGACTCTGGGAAGAGTATGATCAAGCAACTTATAATTTCCTTCCTGAAAAGGAAAGAAATTTGCAAACTTTCTTGTACAAAGTTGGCATTATAAAAAAACAATGCTTTATCAATTGTTGCAACGAACAGGGTGCGTATAGTTCAAAATAAAAATCATTAATTTCCCATTCCGGGTGAGATGCC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTTACTGTGGGGGCGCT

Sequences - 3ʹ (reverse) EST

Accession: JZ837632
dbEST ID: 79655334
Trimmed Sequence: CTTGTTCTCTTTCTCAGGGAAGAAATTATATGTTGCTGGATCATACTCTTCCCAGAGTCGCTCAAACTCCTTCTGATAAGCTTTTACAATCACAGTGTCATCTGTAATGAGAATGTTCTCCTTGTTGGACTGGAATGCTTGGACGGTCCAGTTTAGGGAGCCGGTCAGAACAACTGTCCCGTCAACAACAGCAAACTTGTGGTGCATATAGCCACTGGACTGGTCATGTCGAACTGCAACACCTGCGCTCCGCAGGGGCCCAATCTGAGAGCCGGGGGCAGCCATGTAGTCGTTGTCAGTGATGACTCGGACCCTGACGTCCCTGCGGTGCAAAATAAGCAAGGCCCGGGCCAGGGAGGGACTGGAGAAGGTGAATACACAGAGTTCCAGGCTGCGCTGGGCCCCGAGGAGCTGCACAAAGAGACGGCTGAAAGCGCTGTCGGTGTGAGGGAGTGGACAGGAACATTTCTTCATTGGAGACAAAACCGGCTCGATACTGGTCAGCGGAACCGGAAAGAGAACAACCTCCGCAACAGGCTTTCTCCGCCCCCGGTGCCGAGAAAAACACCTCCTAGGCGGAGAGCGAAAGACGCACGGGGGCCGGGCGGCTAACGTTACCGCCCCCCCCCCAAAAAACATTGGGGCGGGAAGGTTTTGTACCAGAGTTGGCCTGTTATGAAGAAAAACTGGCTTCAACCGGATTGGTTTCCGCGCCAAGCGAGGGGGCAGGTGGGCGGGTGGCCAGGTTGTAAAAAAAAAAAAAAAAAAAAAAA
Full Trace Sequence: GGGGAAACAGGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACTTGTTCTCTTTCTCAGGGAAGAAATTATATGTTGCTGGATCATACTCTTCCCAGAGTCGCTCAAACTCCTTCTGATAAGCTTTTACAATCACAGTGTCATCTGTAATGAGAATGTTCTCCTTGTTGGACTGGAATGCTTGGACGGTCCAGTTTAGGGAGCCGGTCAGAACAACTGTCCCGTCAACAACAGCAAACTTGTGGTGCATATAGCCACTGGACTGGTCATGTCGAACTGCAACACCTGCGCTCCGCAGGGGCCCAATCTGAGAGCCGGGGGCAGCCATGTAGTCGTTGTCAGTGATGACTCGGACCCTGACGTCCCTGCGGTGCAAAATAAGCAAGGCCCGGGCCAGGGAGGGACTGGAGAAGGTGAATACACAGAGTTCCAGGCTGCGCTGGGCCCCGAGGAGCTGCACAAAGAGACGGCTGAAAGCGCTGTCGGTGTGAGGGAGTGGACAGGAACATTTCTTCATTGGAGACAAAACCGGCTCGATACTGGTCAGCGGAACCGGAAAGAGAACAACCTCCGCAACAGGCTTTCTCCGCCCCCGGTGCCGAGAAAAACACCTCCTAGGCGGAGAGCGAAAGACGCACGGGGGCCGGGCGGCTAACGTTACCGCCCCCCCCCCAAAAAACATTGGGGCGGGAAGGTTTTGTACCAGAGTTGGCCTGTTATGAAGAAAAACTGGCTTCAACCGGATTGGTTTCCGCGCCAAGCGAGGGGGCAGGTGGGCGGGTGGCCAGGTTGTAAAAAAAAAAAAAAAAAAAAAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACTTGTTCTCTTTCTCAGGG