ORFeome > plekhb2 ORF1 – XORFeome v1.0

plekhb2 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: plekhb2
Gene ID: 983206
Gene Page ID: 983204
ORF Xenbase ID: 17289543

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC078545
Original XGC clone length: 351

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11004
Well Location: H02

Sequences - 5ʹ (forward) EST

Accession: JZ839747
dbEST ID: 79657449
Trimmed Sequence: ATGGCTTACGTAAAAAGTGGTTGGTTGCTTCGTCAAAGTACAATCTTAAAGCGTTGGAAAAAGAACTGGTTTGATCTGTGGTCCAATGGGTGTCTGGTATATTATAGTGACGAGGAACGTGAAGACATGGAAGATAAGATCTACATGCAGACAGAGTGCATCAGCATCAGAGTAGGAAATGAATGCAGAGATCTAAACCCGCCCGAAGGAAGACAAAAGGATTGCTGCTTGCAGATTGTTTGCCATGAAGGGAAACTTATTAACCTGGTGGCTGAAAGTCCAGACGACTGCTTAGCTTGGGAGACTGCACTAAAGGATGCCCAAACTAAATCTGTGAGTAATGTCTTATT
Full Trace Sequence: GGGGGCTCTAGCTCGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCTTACGTAAAAAGTGGTTGGTTGCTTCGTCAAAGTACAATCTTAAAGCGTTGGAAAAAGAACTGGTTTGATCTGTGGTCCAATGGGTGTCTGGTATATTATAGTGACGAGGAACGTGAAGACATGGAAGATAAGATCTACATGCAGACAGAGTGCATCAGCATCAGAGTAGGAAATGAATGCAGAGATCTAAACCCGCCCGAAGGAAGACAAAAGGATTGCTGCTTGCAGATTGTTTGCCATGAAGGGAAACTTATTAACCTGGTGGCTGAAAGTCCAGACGACTGCTTAGCTTGGGAGACTGCACTAAAGGATGCCCAAACTAAATCTGTGAGTAATGTCTTATTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAACTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGCAAAAACACGTATCTCAAAATCTCTCATGTTACATTGGTGCAGCGGGGTAAAAAATGCTCAAGGCCCCTCGAAAAAAAAAGCTTAGGTGTAAATACTAGTTGAAGGAAGAAACGCCCCAACCACAGGAAATAGGCGGAGTAGGTATTTAACTTTAGGAATCTACCCCGGGGGGGGCGCCGGGGGGTCCGAAACTGGTACGAAAAACAGGGGGGGACGGCCATGGCGCGGTTTTGTGGTTTGTTTAATCTTTTTTTTTTGGTTTTAAAAATATCCTTGGAAATCACAACACACAACCGCGCTCCCCCCGGGCCGCACCC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCTTACGTAAAAAGTGGTTG

Sequences - 3ʹ (reverse) EST

Accession: JZ839746
dbEST ID: 79657448
Trimmed Sequence: TAAGACATTACTCACAGATTTAGTTTGGGCATCCTTTAGTGCAGTCTCCCAAGCTAAGCAGTCGTCTGGACTTTCAGCCACCAGGTTAATAAGTTTCCCTTCATGGCAAACAATCTGCAAGCAGCAATCCTTTTGTCTTCCTTCGGGCGGGTTTAGATCTCTGCATTCATTTCCTACTCTGATGCTGATGCACTCTGTCTGCATGTAGATCTTATCTTCCATGTCTTCACGTTCCTCGTCACTATAATATACCAGACACCCATTGGACCACAGATCAAACCAGTTCTTTTTCCAACGCTTTAAGATTGTACTTTGACGAAGCAACCAACCACTTTTTACGTAAGCCATGG
Full Trace Sequence: GGGAATCTGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCNTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATAAGACATTACTCACAGATTTAGTTTGGGCATCCTTTAGTGCAGTCTCCCAAGCTAAGCAGTCGTCTGGACTTTCAGCCACCAGGTTAATAAGTTTCCCTTCATGGCAAACAATCTGCAAGCAGCAATCCTTTTGTCTTCCTTCGGGCGGGTTTAGATCTCTGCATTCATTTCCTACTCTGATGCTGATGCACTCTGTCTGCATGTAGATCTTATCTTCCATGTCTTCACGTTCCTCGTCACTATAATATACCAGACACCCATTGGACCACAGATCAAACCAGTTCTTTTTCCAACGCTTTAAGATTGTACTTTGACGAAGCAACCAACCACTTTTTACGTAAGCCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGGGGCCCGAGCTTAAAAATGGCCGTCGGTTTACAACTACCTGACTGGGGAAACGCCCGGGGCAAAAATACCAAAGCTCACTCCAAAAAAGGGTCATCGGGTACCTGCGGTTAAGCGGGAGGAGGCCGACCCTGGAAACATCACCAGGGGCGGGTTTGGGTTTGTGGAAATAGCGGTGGGCGTGGGCTACTGGGCCGGAACCTGGGCGAGAACAACGCGGCTCCGGGGAAAAGAGAGTTCCTGCCGCGGGTATAAGTTATTTTGGGGAGTTTTTACCCTCCCGCGCCCCCGCCCGGACCGGGGGCGCGNCCCGGGGGCCC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATAAGACATTACTCACAGATTT