ORFeome > plekhf2 ORF1 – XORFeome v1.0

plekhf2 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: plekhf2
Gene ID: 959916
Gene Page ID: 959910
ORF Xenbase ID: 17289555

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC129700
Original XGC clone length: 747

Human orthology & disease relationships

NCBI Entrez ID: 79666
Ensembl gene IDs: ENSG00000175895
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 219100,259900,600794,601472,606664

Library Location

Plate ID: GDExl11091
Well Location: H04

Sequences - 5ʹ (forward) EST

Accession: JZ838621
dbEST ID: 79656323
Trimmed Sequence: ATGGTTGATCGCTTAGCAAACAGCGAGGCAAATACAAAACGTATAAACCTAGTGGAAAATTGCTTTGGAACAGCTGGCCAGCCGTTGGCAATCCCTGGCCGAGTTCTCATTGGAGAAGGGGTGCTAACAAAACTTTGCAGAAAGAAACCAAAAGCCAGACAATTTTTCCTGTTCAATGATATTCTAGTCTATGGCAATATTGTTATTCAGAAGAAAAAGTACAACAAGCAGCACATTATCCCTCTTGAAAACGTTACCATTGACACCATTGACGATGAAGGAGAGCTGCGAAATGGCTGGTTGATTAAAACTCCAACAAAATCATTTGCCGTTTATGCTGCCACGGCGACCGAAAAATCCGAATGGATGAATCACATTAATAAGTGCGTTTGTGATTTAATCTCCAAAAGCGGGAAGACGCCTAACAGTGAACATGCTGCAGTCTGGATACCAGATTCCGAGGCATCGATTTGCATGCGCTGTAAAAAAGTGAAATTTACCCCCGTTAATCGCAAGCATCACTGCCCGAAATGTGGATATGTCATTTGTGGACCTTGCTCGGAGAAAAAGTATCTTTTGCCAAGTCCGTCCTCCAAGCCTGTGCGCGTTTGTGAATTCGGGTATGATCTGTTATCCCGTGGGGAATTTCTCTTCAGGTCTGCCCAGGCAGGTCGGACCCCTTCTTCCAACCCTTCAAAATTCCAAAAAAAATTTGTAAAATAGAGGAAAAACCAAT
Full Trace Sequence: CTCGGGGGCCATATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGTTGATCGCTTAGCAAACAGCGAGGCAAATACAAAACGTATAAACCTAGTGGAAAATTGCTTTGGAACAGCTGGCCAGCCGTTGGCAATCCCTGGCCGAGTTCTCATTGGAGAAGGGGTGCTAACAAAACTTTGCAGAAAGAAACCAAAAGCCAGACAATTTTTCCTGTTCAATGATATTCTAGTCTATGGCAATATTGTTATTCAGAAGAAAAAGTACAACAAGCAGCACATTATCCCTCTTGAAAACGTTACCATTGACACCATTGACGATGAAGGAGAGCTGCGAAATGGCTGGTTGATTAAAACTCCAACAAAATCATTTGCCGTTTATGCTGCCACGGCGACCGAAAAATCCGAATGGATGAATCACATTAATAAGTGCGTTTGTGATTTAATCTCCAAAAGCGGGAAGACGCCTAACAGTGAACATGCTGCAGTCTGGATACCAGATTCCGAGGCATCGATTTGCATGCGCTGTAAAAAAGTGAAATTTACCCCCGTTAATCGCAAGCATCACTGCCCGAAATGTGGATATGTCATTTGTGGACCTTGCTCGGAGAAAAAGTATCTTTTGCCAAGTCCGTCCTCCAAGCCTGTGCGCGTTTGTGAATTCGGGTATGATCTGTTATCCCGTGGGGAATTTCTCTTCAGGTCTGCCCAGGCAGGTCGGACCCCTTCTTCCAACCCTTCAAAATTCCAAAAAAAATTTGTAAAATAGAGGAAAAACCAAT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGTTGATCGCTTAGCAAACA

Sequences - 3ʹ (reverse) EST

Accession: JZ838620
dbEST ID: 79656322
Trimmed Sequence: GTCACTGCTGTCCTCATCGTCGTCGTCATCTGACAAATTATTTTTGAACTTTGAAGGTTGGGAGAAGGAGTCCGACCTGCTAGGCAGACATGAAGAGAAATCCCCACTGGATAACAGATCATAGCAGAAATCACAAACGCGCACAGGCTTGGAAGACTGACTTGGCAAAAGATACTTCTTCTCCGAGCAAGGTCCACAAATGACATATCCACATTTCCGGCAGTGATGCCTGCGATTAACGGGGGTAAATTTCACTTTTTTACAGCGCATGCAAATCGATGCCTCGGAATCTGGTATCCAGACTGCAGCATGTTCACTGTTAGGCGTCTTCCCGCTTTTGGAGATTAAATCACAAACGCACTTATTAATGTGATTCATCCATTCGGATTTTTCGGTCGCCGTGGCAGCATAAACGGCAAATGATTTTGTTGGAGTTTTAATCAACCAGCCATTTCGCAGCTCTCCTTCATCGTCAATGGTGTCAATGGTAACGTTTTCAAGAGGGATAATGTGCTGCTTGTTGTACTTTTTCTTCTGAATAACAATATTGCCATAGACGAGAATATCATTGAACAGGAAAAATTGTCTGGCTTTTGGTTTCTTTTTTCAAAATTTTTGTAGCGGCCCCTTCCCCAATAAAACTCCGACAAAGGAATTGGCAAGGGGCTGGGCGGGTTGTGCCAAAGCAAATTTTTCAACTAGGGTTTTAAAACTTTTGTGATTTTTGCCTTCGTCTTTTTTACTTAAGAGCGAAACAAACAAG
Full Trace Sequence: GGGAAAAAGGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTCACTGCTGTCCTCATCGTCGTCGTCATCTGACAAATTATTTTTGAACTTTGAAGGTTGGGAGAAGGAGTCCGACCTGCTAGGCAGACATGAAGAGAAATCCCCACTGGATAACAGATCATAGCAGAAATCACAAACGCGCACAGGCTTGGAAGACTGACTTGGCAAAAGATACTTCTTCTCCGAGCAAGGTCCACAAATGACATATCCACATTTCCGGCAGTGATGCCTGCGATTAACGGGGGTAAATTTCACTTTTTTACAGCGCATGCAAATCGATGCCTCGGAATCTGGTATCCAGACTGCAGCATGTTCACTGTTAGGCGTCTTCCCGCTTTTGGAGATTAAATCACAAACGCACTTATTAATGTGATTCATCCATTCGGATTTTTCGGTCGCCGTGGCAGCATAAACGGCAAATGATTTTGTTGGAGTTTTAATCAACCAGCCATTTCGCAGCTCTCCTTCATCGTCAATGGTGTCAATGGTAACGTTTTCAAGAGGGATAATGTGCTGCTTGTTGTACTTTTTCTTCTGAATAACAATATTGCCATAGACGAGAATATCATTGAACAGGAAAAATTGTCTGGCTTTTGGTTTCTTTTTTCAAAATTTTTGTAGCGGCCCCTTCCCCAATAAAACTCCGACAAAGGAATTGGCAAGGGGCTGGGCGGGTTGTGCCAAAGCAAATTTTTCAACTAGGGTTTTAAAACTTTTGTGATTTTTGCCTTCGTCTTTTTTACTTAAGAGCGAAACAAACAAG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTCACTGCTGTCCTCATC