ORFeome > plk1 ORF1 – XORFeome v1.0

plk1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: plk1
Gene ID: 941545
Gene Page ID: 941539
ORF Xenbase ID: 17289579

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC046839
Original XGC clone length: 1797

Human orthology & disease relationships

NCBI Entrez ID: 5347
Ensembl gene IDs: ENSG00000166851
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 145260,148820,168500,181450,193500,216400,278780,604757

Library Location

Plate ID: GDExl11011
Well Location: D12

Sequences - 5ʹ (forward) EST

Accession: JZ823930
dbEST ID: 79641632
Trimmed Sequence: ATGGCTCAAGTGGCCGGTAAGAAACTGACTGTGGCCCCAGAGGCCGCTAAACCCCCAGGAATTCCCGGGAGCTCCTCGGCCGTCAAAGAGATCCCAGAGATTCTAGTGGATCCCCGAACCCGGAGGCGATACCTGAGAGGTCGATTCCTGGGCAAAGGTGGATTCGCCAAGTGCTACGAGATCACCGACCTGGAGAGCCGGGAGGTATTTGCTGGGAAGATTGTGCCCAAGACCATGTTACTCAAGCCCCACCAGAAGGATAAGATGACCATGGAGATCGCCATCCAGCGCAGCCTGGACCACCGGCATGTCGTGGGCTTCCATGGCTTCTTTGAGGACAATGACTTCGTGTATGTGGTACTGGAGCTGTGCAGGAGGAGGTCTCTGTTGGAGCTGCACAAGAGGAGAAAAGCGGTTACAGAGCCAGAAGCTCGCTACTATTTGAAACAGACCATTTCGGGATGTCAGTATCTCCATAGCAACCGAGTCATTCACAGAGACCTCAAGCTCGGAAACTTGTTCCTTAATGATGAAATGGAGGTCAAAATAGGTGACTTTGGGCTGGCAACCAAAGTGGAATATGATGGCGAGCGCAAAAAGACCCTCTGTGGCACTCCAAACTACATTGCACCCTGANGTGTTGGGCAAGAAGGGCACNAGTTTTGAAGTNACATATGGTCAATANGATGCATCATGTACACACTGCTTGGTGGGGGAACCCTTCCCTTTGAAACATCATGCCCTTAAAAGAAACCTACCTGAAAAATAAAAAGAAATAATAACTCCATCCCCCAAACCATTTAACCCCGGGGGCCCGCCCCTTTTAAAAAAAAAAAAA
Full Trace Sequence: AAATGATTTTTAATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCTCAAGTGGCCGGTAAGAAACTGACTGTGGCCCCAGAGGCCGCTAAACCCCCAGGAATTCCCGGGAGCTCCTCGGCCGTCAAAGAGATCCCAGAGATTCTAGTGGATCCCCGAACCCGGAGGCGATACCTGAGAGGTCGATTCCTGGGCAAAGGTGGATTCGCCAAGTGCTACGAGATCACCGACCTGGAGAGCCGGGAGGTATTTGCTGGGAAGATTGTGCCCAAGACCATGTTACTCAAGCCCCACCAGAAGGATAAGATGACCATGGAGATCGCCATCCAGCGCAGCCTGGACCACCGGCATGTCGTGGGCTTCCATGGCTTCTTTGAGGACAATGACTTCGTGTATGTGGTACTGGAGCTGTGCAGGAGGAGGTCTCTGTTGGAGCTGCACAAGAGGAGAAAAGCGGTTACAGAGCCAGAAGCTCGCTACTATTTGAAACAGACCATTTCGGGATGTCAGTATCTCCATAGCAACCGAGTCATTCACAGAGACCTCAAGCTCGGAAACTTGTTCCTTAATGATGAAATGGAGGTCAAAATAGGTGACTTTGGGCTGGCAACCAAAGTGGAATATGATGGCGAGCGCAAAAAGACCCTCTGTGGCACTCCAAACTACATTGCACCCTGANGTGTTGGGCAAGAAGGGCACNAGTTTTGAAGTNACATATGGTCAATANGATGCATCATGTACACACTGCTTGGTGGGGGAACCCTTCCCTTTGAAACATCATGCCCTTAAAAGAAACCTACCTGAAAAATAAAAAGAAATAATAACTCCATCCCCCAAACCATTTAACCCCGGGGGCCCGCCCCTTTTAAAAAAAAAAAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCTCAAGTGGCCGGT

Sequences - 3ʹ (reverse) EST

Accession: JZ829239
dbEST ID: 79646941
Trimmed Sequence: TGCTGAGGCCTTTACATGTGCAACGGCTGACTTTGAGCTCTGAAGTTTCTCCACCATTGTGCGTGCGTAGCGGAGACGGCTTGCGAGCTCTTTGCAGCAGCCAAATTCTTGAATCAAGCTCAGCTTGTACGTGCGGAACTCACGCTTTTCATCTATGTAGGACACAGCAGCCATAAGGGGGCACAGGATTATCTTGGTGTGATCCTGGAAGAAGTTGATCTGAACAGTTCCATTGCTCAGGTGGAGGATAATGGCACTGCGTGTCCGGAACCAGGTGCGCAAGAAGGGGAGACGAGCCAGTTCATCGCCCTCCCGAGGAGTCGTGTTGGCACCGGCCTTCAATAGGTGCTCACTCATGTAGTTTCTGAAGTACTTCAGCAGTGTGATCTTTTTGGTTAAGGTAGTAGGGTAGGAGCGCACGTTGAGGTAGGATTCTGTATTGTTCCGCTCAATGTACTGCAGGCTGTCTCCATCATTGTACATTATCAACCGTGTGGAGTCATTGAAGAGCACCCCTACACTGTTATCACACAGCTGATATCCTAATCCGTATTTGTCCGAGTAATCCACCCATTTGCTGATCCAGAATATGGGAAATGGATGCCGGGATCCTCCGGCTTCCTTCTTGGCGGATAAGCGGCTCTCTCCAAGGGGTTTGACTTGCATTCAAACCTGGTCA
Full Trace Sequence: GTGGCAGGAAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATGCTGAGGCCTTTACATGTGCAACGGCTGACTTTGAGCTCTGAAGTTTCTCCACCATTGTGCGTGCGTAGCGGAGACGGCTTGCGAGCTCTTTGCAGCAGCCAAATTCTTGAATCAAGCTCAGCTTGTACGTGCGGAACTCACGCTTTTCATCTATGTAGGACACAGCAGCCATAAGGGGGCACAGGATTATCTTGGTGTGATCCTGGAAGAAGTTGATCTGAACAGTTCCATTGCTCAGGTGGAGGATAATGGCACTGCGTGTCCGGAACCAGGTGCGCAAGAAGGGGAGACGAGCCAGTTCATCGCCCTCCCGAGGAGTCGTGTTGGCACCGGCCTTCAATAGGTGCTCACTCATGTAGTTTCTGAAGTACTTCAGCAGTGTGATCTTTTTGGTTAAGGTAGTAGGGTAGGAGCGCACGTTGAGGTAGGATTCTGTATTGTTCCGCTCAATGTACTGCAGGCTGTCTCCATCATTGTACATTATCAACCGTGTGGAGTCATTGAAGAGCACCCCTACACTGTTATCACACAGCTGATATCCTAATCCGTATTTGTCCGAGTAATCCACCCATTTGCTGATCCAGAATATGGGAAATGGATGCCGGGATCCTCCGGCTTCCTTCTTGGCGGATAAGCGGCTCTCTCCAAGGGGTTTGACTTGCATTCAAACCTGGTCA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATGCTGAGGCCTTTACATGTGCAA