ORFeome > plk2 ORF1 – XORFeome v1.0

plk2 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: plk2
Gene ID: 1006209
Gene Page ID: 1006204
ORF Xenbase ID: 17289585

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC042254
Original XGC clone length: 2001

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11016
Well Location: H01

Sequences - 5ʹ (forward) EST

Accession: JZ824319
dbEST ID: 79642021
Trimmed Sequence: ATGGAATTACTGAGGAATATCGCTTATCAGCCAAGCAGCGGGGGCAAGATGTGCGAGCAGGCTCTGGGCAGGGTGTGTGACCCCGACAGGAGGTGGAAGGTACCGGGCGATGGGGAACCCATTCATCACAGCTGCTCTGCCACTGACGTGTCCAGGATTATAACCGACCCCGGCACCGGGAGGCGCTACTGCAGGGGCAAAGTGCTTGGCAAGGGTGGATTTGCGAAATGCTATGAAATGAAAGATTTGACAACAAACAAGATCTATGCTGCTAAAATCATCCCGCACAGCAGGGTATCGAAGCCTCATCAAAGGGAAAAGATTGACAAAGAGATCGAATTGCACAGAACCCTGAATCACAGGCACGTCGTACAGTTCTACCACTATTTTGAAGACAAAGAGAACATCTACATCTTAATGGAATACTGCGGTCGGCGGTCCATGGCCCACATTTTGAAGACCAGGAAAGTTTTGACGGACCCTGAAGTGAGATACTACCTCAAGCAAATTGTCTCTGGTCTGAAATATCTCCATGAGCAAGAGATCCTCCACCGGGATTTAAAATTAGGAAACTTTTTCATTAATGAAAGCATGGAACTGAAAGTGGGTGACTTTGGCCTTGCAGCCAGACTGGAACCTCTGGAACAGAGAAGAAGAAACATTTGTGGCACGCCGAATTACCTCTCCCCGAAGTGCTTACAAACAAGGGCACGGCTGTGAATCTGACATCTGGGGCATTGGGCTGTGGTATGTATAACATGCTTGCTGGGAAGACGCCCGTTCCAAACCCCAATTCTTAAGAAAACATTACAAAGGTATTCGGGAAACCAAAAA
Full Trace Sequence: TAGTGATTTTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGAATTACTGAGGAATATCGCTTATCAGCCAAGCAGCGGGGGCAAGATGTGCGAGCAGGCTCTGGGCAGGGTGTGTGACCCCGACAGGAGGTGGAAGGTACCGGGCGATGGGGAACCCATTCATCACAGCTGCTCTGCCACTGACGTGTCCAGGATTATAACCGACCCCGGCACCGGGAGGCGCTACTGCAGGGGCAAAGTGCTTGGCAAGGGTGGATTTGCGAAATGCTATGAAATGAAAGATTTGACAACAAACAAGATCTATGCTGCTAAAATCATCCCGCACAGCAGGGTATCGAAGCCTCATCAAAGGGAAAAGATTGACAAAGAGATCGAATTGCACAGAACCCTGAATCACAGGCACGTCGTACAGTTCTACCACTATTTTGAAGACAAAGAGAACATCTACATCTTAATGGAATACTGCGGTCGGCGGTCCATGGCCCACATTTTGAAGACCAGGAAAGTTTTGACGGACCCTGAAGTGAGATACTACCTCAAGCAAATTGTCTCTGGTCTGAAATATCTCCATGAGCAAGAGATCCTCCACCGGGATTTAAAATTAGGAAACTTTTTCATTAATGAAAGCATGGAACTGAAAGTGGGTGACTTTGGCCTTGCAGCCAGACTGGAACCTCTGGAACAGAGAAGAAGAAACATTTGTGGCACGCCGAATTACCTCTCCCCGAAGTGCTTACAAACAAGGGCACGGCTGTGAATCTGACATCTGGGGCATTGGGCTGTGGTATGTATAACATGCTTGCTGGGAAGACGCCCGTTCCAAACCCCAATTCTTAAGAAAACATTACAAAGGTATTCGGGAAACCAAAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAATTACTGAGGAATATCGCT

Sequences - 3ʹ (reverse) EST

Accession: JZ829677
dbEST ID: 79647379
Trimmed Sequence: GGCAACTTCATTGCATCGTTGCAGCAACATGTTCAATGCATATTCCATTCTGTTCTTCAGATCACTGGAGCCACCGGATATCAGAAGGGTGCTCAGGTGGAAGGTGGTAGACATCCTGTCCTCGTTGATATAGGTTAGCACGTATTCATCATTCTGGTTTGCGATAATGATTTTCGTGTGATCATGGTAAAAGTTGACCTGAAATGTGCCATCATTGAAGAGCATCATTAGAGCCTTGTCAGATTTCAGCCACTGAAGAAGATACAGCCTAGGCCGGCAAACATCTGTTACACTGGGCAAGTCACCTCCATCCATCAGATTCTCTTCCATGTAATGAGAGAAGTACTTCAAAACTGTAACTTGACTGATGAACTGCTCAGGGGCCTCAGTGGCAGGAAACACAGAGCACTGTCCAAGCTCAGCATAGTAATGCACAGTCTTTTTGTCTGGCAGAAAACTCATGTGCGCTCCATTGTTGAACAATACGCCAACTGTGTGATCCGACAGCTGATAACCAAAGCCGTACTTTGTTGGAGTAGTCCACCCATTTGGTTACCCAGTGGGAAGGAAGTGTCTATCTGTTCTTTAGGGATAGCATCAGCGTCGGGCATTTTTTCTAGACAGTCTTTTAGAACTCCGGGCACAGTAACTGCCACAAGTCCCATTGTGCCATCTTCAAAACATTCACTGCTGCTACTGGGACTTTTCCAAAGGTTCCCCCTGAAAAATACGGGTGAATGGGGATCCTTCCCAAATAGCCTGTTTTTGTCC
Full Trace Sequence: TGGCGGGTATCAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGGCAACTTCATTGCATCGTTGCAGCAACATGTTCAATGCATATTCCATTCTGTTCTTCAGATCACTGGAGCCACCGGATATCAGAAGGGTGCTCAGGTGGAAGGTGGTAGACATCCTGTCCTCGTTGATATAGGTTAGCACGTATTCATCATTCTGGTTTGCGATAATGATTTTCGTGTGATCATGGTAAAAGTTGACCTGAAATGTGCCATCATTGAAGAGCATCATTAGAGCCTTGTCAGATTTCAGCCACTGAAGAAGATACAGCCTAGGCCGGCAAACATCTGTTACACTGGGCAAGTCACCTCCATCCATCAGATTCTCTTCCATGTAATGAGAGAAGTACTTCAAAACTGTAACTTGACTGATGAACTGCTCAGGGGCCTCAGTGGCAGGAAACACAGAGCACTGTCCAAGCTCAGCATAGTAATGCACAGTCTTTTTGTCTGGCAGAAAACTCATGTGCGCTCCATTGTTGAACAATACGCCAACTGTGTGATCCGACAGCTGATAACCAAAGCCGTACTTTGTTGGAGTAGTCCACCCATTTGGTTACCCAGTGGGAAGGAAGTGTCTATCTGTTCTTTAGGGATAGCATCAGCGTCGGGCATTTTTTCTAGACAGTCTTTTAGAACTCCGGGCACAGTAACTGCCACAAGTCCCATTGTGCCATCTTCAAAACATTCACTGCTGCTACTGGGACTTTTCCAAAGGTTCCCCCTGAAAAATACGGGTGAATGGGGATCCTTCCCAAATAGCCTGTTTTTGTCC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGGCAACTTCATTGCATCGT