ORFeome > plp1 ORF1 – XORFeome v1.0

plp1 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: plp1
Gene ID: 6255820
Gene Page ID: 1008579
ORF Xenbase ID: 17289609

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC053789
Original XGC clone length: 921

Human orthology & disease relationships

NCBI Entrez ID: 5354
Ensembl gene IDs: ENSG00000123560
Directly associated (OMIM) disease MIM numbers: 312080,312920
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11002
Well Location: C08

Sequences - 5ʹ (forward) EST

Accession: JZ839395
dbEST ID: 79657097
Trimmed Sequence: ATGGGTTGGCATGATGGCTGCATACGCTGCATGGTTGGGGTACCATTTGCTTCAGTCATTGCCACAGTCCTGTGTTTTGCCGGAGTGGCCCTATTCTGTGGCTGCGGACATGAGGCTTTGAGTGGAACAGAGAAGTTGATAGAGACATATTTTTCCAAAAACTACCAGGAGTATGAATACCTCATTCATGTAATTAATGCCTTTCAGTATGTGATCTATGGAATTGCCATTTTCTTCTTTCTGTATGGGATCCTACTTTTGGCTGAGGGATTCTATACAACAACTGCCATCAAACACATCCTAGGAGAGTTCAAACCCCCAGCTATGAAGGGTGGGCTCATCTCTACAGTGACTGGAGGACCACCTAAAGGAAGAAGCACCAGGGGAAGGCAGCCAGTCCATACTATAGAGCTCATCTGCCGCTGCTTGGGAAAGTGGCTTGGACACCCCGATAAGTTTGTCGGTGTCACTTACGTTATCACTATTTTGTGGATCCTGATCTTTGCCTGCTCTGCTGTCCCTGTCTACATTTACTTCAATACTTGGGTCACCTGTCAGTCCATTGCATTCCCAGGGAAAACCACAACCAGTGTCAGTACCCTGTGTTTAGATGCTCGTATGTATGGTGTTCTGCCATGGAATGCTTTCCCCAGGCAAGTAATGCGGGAACAGTCTGGCTTGCCATCTGCCAAAACATTGAGTTTCAAAATGAAAATTTCCACCTTTTTATTTTCGTCATTTTTGGGGTTGCGCCTGCCAACCCGTTTGTGGGCCCTAAATACCGCCCCCCTCAATTGTTTCCTTTTCGGCCCCAAAAGG
Full Trace Sequence: CGGGGGCCAAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGGTTGGCATGATGGCTGCATACGCTGCATGGTTGGGGTACCATTTGCTTCAGTCATTGCCACAGTCCTGTGTTTTGCCGGAGTGGCCCTATTCTGTGGCTGCGGACATGAGGCTTTGAGTGGAACAGAGAAGTTGATAGAGACATATTTTTCCAAAAACTACCAGGAGTATGAATACCTCATTCATGTAATTAATGCCTTTCAGTATGTGATCTATGGAATTGCCATTTTCTTCTTTCTGTATGGGATCCTACTTTTGGCTGAGGGATTCTATACAACAACTGCCATCAAACACATCCTAGGAGAGTTCAAACCCCCAGCTATGAAGGGTGGGCTCATCTCTACAGTGACTGGAGGACCACCTAAAGGAAGAAGCACCAGGGGAAGGCAGCCAGTCCATACTATAGAGCTCATCTGCCGCTGCTTGGGAAAGTGGCTTGGACACCCCGATAAGTTTGTCGGTGTCACTTACGTTATCACTATTTTGTGGATCCTGATCTTTGCCTGCTCTGCTGTCCCTGTCTACATTTACTTCAATACTTGGGTCACCTGTCAGTCCATTGCATTCCCAGGGAAAACCACAACCAGTGTCAGTACCCTGTGTTTAGATGCTCGTATGTATGGTGTTCTGCCATGGAATGCTTTCCCCAGGCAAGTAATGCGGGAACAGTCTGGCTTGCCATCTGCCAAAACATTGAGTTTCAAAATGAAAATTTCCACCTTTTTATTTTCGTCATTTTTGGGGTTGCGCCTGCCAACCCGTTTGTGGGCCCTAAATACCGCCCCCCTCAATTGTTTCCTTTTCGGCCCCAAAAGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGGTTGGCATGATGGCT

Sequences - 3ʹ (reverse) EST

Accession: JZ839394
dbEST ID: 79657096
Trimmed Sequence: CAACAGGTTCTCTGCACTCCTTTGGGGGGTCTCTGGCAGAATATCAGTGAGTTCTGAGCTCTCAGCCTGTGGTGTCTCCTGGCTTTTCCCCTTTTCCTCTAGGACACGCTGTTGATACACCCTGTTGGCCGACAGACACATGAGGGCGTGTATCAGGGCCACAAGTGTTGCAGCTGCACCCACAAATGCCGCAATAAAAAGGTGAAATGTCATCTGGAACTCACTGGTCTTGCAGATGGCAAGCAGACTGGTCCCGCATACTTTCCCTGGGAAAGCATTCCATGGCAGAACACCATACATACGAGCATCTAAACACAGGGTACTGACACTGGTTGTGGTTTTCCCTGGGAATGCAATGGACTGACAGGTGACCCAAGTATTGAAGTAAATGTAGACAGGGACAGCAGAGCAGGCAAAGATCAGGATCCACAAAATAGTGATAACGTAAGTGACACCGACAAACTTATCGGGGTGTCCAAGCCACTTTCCCAAGCAGCGGCAGATGAGCTCTATAGTATGGACTGGCTGCCTTCCCCTGGTGCTTCTTCCTTTAGGTGGTCCTCCAGTCACTGTAAAGATGAGCCCACCCTTCATAGCTGGGGGTTTGAACTCTCCTAGGATGTGTTTGAATGGCAGTTGTTGTAAAAAAACCCCTCAGCCAAAAAGTTAGAAACCCCATAACAAAAAGAAAAAAAAATGGCAATTTCCATTAAAATCACATAACTGGAAAAGGGCATTAAAATTTACTTTTGAAAAGAAGG
Full Trace Sequence: GGGGAATCAGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACAACAGGTTCTCTGCACTCCTTTGGGGGGTCTCTGGCAGAATATCAGTGAGTTCTGAGCTCTCAGCCTGTGGTGTCTCCTGGCTTTTCCCCTTTTCCTCTAGGACACGCTGTTGATACACCCTGTTGGCCGACAGACACATGAGGGCGTGTATCAGGGCCACAAGTGTTGCAGCTGCACCCACAAATGCCGCAATAAAAAGGTGAAATGTCATCTGGAACTCACTGGTCTTGCAGATGGCAAGCAGACTGGTCCCGCATACTTTCCCTGGGAAAGCATTCCATGGCAGAACACCATACATACGAGCATCTAAACACAGGGTACTGACACTGGTTGTGGTTTTCCCTGGGAATGCAATGGACTGACAGGTGACCCAAGTATTGAAGTAAATGTAGACAGGGACAGCAGAGCAGGCAAAGATCAGGATCCACAAAATAGTGATAACGTAAGTGACACCGACAAACTTATCGGGGTGTCCAAGCCACTTTCCCAAGCAGCGGCAGATGAGCTCTATAGTATGGACTGGCTGCCTTCCCCTGGTGCTTCTTCCTTTAGGTGGTCCTCCAGTCACTGTAAAGATGAGCCCACCCTTCATAGCTGGGGGTTTGAACTCTCCTAGGATGTGTTTGAATGGCAGTTGTTGTAAAAAAACCCCTCAGCCAAAAAGTTAGAAACCCCATAACAAAAAGAAAAAAAAATGGCAATTTCCATTAAAATCACATAACTGGAAAAGGGCATTAAAATTTACTTTTGAAAAGAAGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACAACAGGTTCTCTGCACTC