ORFeome > plp2 ORF1 – XORFeome v1.0

plp2 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: plp2
Gene ID: 1015509
Gene Page ID: 1015502
ORF Xenbase ID: 17289621

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC123178
Original XGC clone length: 459

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11087
Well Location: H11

Sequences - 5ʹ (forward) EST

Accession: JZ838063
dbEST ID: 79655765
Trimmed Sequence: ATGTCCGACCCCGGACCCCAGGGCGGCGAGAGCTGCATGAGCCTGTTCCGCTCCTACCTGCGCACCAGGAAAGGGATCATCCTCGCCGCGGAGACGGTGCTGTGCTTTGTTATCGTGGTGTGTTATGGAGCCTCTAATGTTGCCGGGTACCTCGCAGTTGCTGTCATTGAACTCATATTCTGCATCATATATTTTGTTGTCTTTGCAGGCAAATATGATAAACAGCTGACCTTCATTCACTGGGGATGGAGTGATTTCCTGCGTTGTGCCGTTGCATGTCTACTCTTCCTCATCACGTCCCTTATCACGTTGCTCAGTCGTAGCGATGGAGCTGGCATAGCAGGAGCGGTTTTCGGACTTTTAGCTGGAATCCTATTTGGTTACGATGGATACACCACTATACCGCTCCTGAGAAAAGCCCACACATCAGTTCCAACAGAAAACCAGGAAGGTGTTTT
Full Trace Sequence: TCGAGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTCCGACCCCGGACCCCAGGGCGGCGAGAGCTGCATGAGCCTGTTCCGCTCCTACCTGCGCACCAGGAAAGGGATCATCCTCGCCGCGGAGACGGTGCTGTGCTTTGTTATCGTGGTGTGTTATGGAGCCTCTAATGTTGCCGGGTACCTCGCAGTTGCTGTCATTGAACTCATATTCTGCATCATATATTTTGTTGTCTTTGCAGGCAAATATGATAAACAGCTGACCTTCATTCACTGGGGATGGAGTGATTTCCTGCGTTGTGCCGTTGCATGTCTACTCTTCCTCATCACGTCCCTTATCACGTTGCTCAGTCGTAGCGATGGAGCTGGCATAGCAGGAGCGGTTTTCGGACTTTTAGCTGGAATCCTATTTGGTTACGATGGATACACCACTATACCGCTCCTGAGAAAAGCCCACACATCAGTTCCAACAGAAAACCAGGAAGGTGTTTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATACCTGTTTCCTGGAAAAAATAAAAAATGTCAATATCAAATTATGTTACACCTGCCCCCCCCCCAAAAAAAAGGGCCCCCTTTCTTCCCCCCCTTTTTGTTGGTGGTGGTTTGGGTGGGGGTTGGGGGAGGAAAAAAACAAAAAAAAGGAAATTGTATGATTTTGGATTAATGGCGGTGGGGGGTGGGGGCCCTCGCCA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCCGACCCCGGACC

Sequences - 3ʹ (reverse) EST

Accession: JZ838062
dbEST ID: 79655764
Trimmed Sequence: AACACCTTCCTGGTTTTCTGTTGGAACTGATGTGTGGGCTTTTCTCAGGAGCGGTATAGTGGTGTATCCATCGTAACCAAATAGGATTCCAGCTAAAAGTCCGAAAACCGCTCCTGCTATGCCAGCTCCATCGCTACGACTGAGCAACGTGATAAGGGACGTGATGAGGAAGAGTAGACATGCAACGGCACAACGCAGGAAATCACTCCATCCCCAGTGAATGAAGGTCAGCTGTTTATCATATTTGCCTGCAAAGACAACAAAATATATGATGCAGAATATGAGTTCAATGACAGCAACTGCGAGGTACCCGGCAACATTAGAGGCTCCATAACACACCACGATAACAAAGCACAGCACCGTCTCCGCGGCGAGGATGATCCCTTTCCTGGTGCGCAGGTAGGAGCGGAACAGGCTCATGCAGCTCTCGCCGCCCTGGGGTCCGGGGTCGGACATGG
Full Trace Sequence: CGGGAATCAGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCNTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAACACCTTCCTGGTTTTCTGTTGGAACTGATGTGTGGGCTTTTCTCAGGAGCGGTATAGTGGTGTATCCATCGTAACCAAATAGGATTCCAGCTAAAAGTCCGAAAACCGCTCCTGCTATGCCAGCTCCATCGCTACGACTGAGCAACGTGATAAGGGACGTGATGAGGAAGAGTAGACATGCAACGGCACAACGCAGGAAATCACTCCATCCCCAGTGAATGAAGGTCAGCTGTTTATCATATTTGCCTGCAAAGACAACAAAATATATGATGCAGAATATGAGTTCAATGACAGCAACTGCGAGGTACCCGGCAACATTAGAGGCTCCATAACACACCACGATAACAAAGCACAGCACCGTCTCCGCGGCGAGGATGATCCCTTTCCTGGTGCGCAGGTAGGAGCGGAACAGGCTCATGCAGCTCTCGCCGCCCTGGGGTCCGGGGTCGGACATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCGGCCCGACCTTAAGACAAAAAAACAAATGACACAATAAAAAACTGAGATTGAAGCGCGTGGCCACACAAAAAAAAAAAAAAGGCCCACCCCCAGTCGCCGCCTTCTTTTTTTTTGGGTTGTTTCCTGGGGGGAGAAGAATAAAAAAAAGAAAAAACCCCGGGGCAGAAGAGGTGTTGGGGGGTGTGGGGGAAATGGGGGAAGGGAGGGGGTGGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAACACCTTCCTGGTTTTCTG