ORFeome > plscr2 ORF1 – XORFeome v1.0

plscr2 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: plscr2
Gene ID: 5819758
Gene Page ID: 5819743
ORF Xenbase ID: 17289639

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC126054
Original XGC clone length: 1065

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11085
Well Location: B09

Sequences - 5ʹ (forward) EST

Accession: JZ837765
dbEST ID: 79655467
Trimmed Sequence: ATGGAAATGAAAGATACCAGTGAACCTAAACCCGATCCTGGTTATGGCAACCAAGGTTACCCAGGGGCAGATTATCCAGGTTATCCCCCACCACAAAATCCTTATGGGTACCAACCTGCTGGATATCCACCTGCTGGGTACCAACCTACTGGATATCCACCTGCTGGGTATCAGCCTGCTGGATATCCACCTGCTGGGTACCAACCTGCTGGATATCCACCTGCTGGGTACCAACCTGCTGGATATCCACCTCCTGGTGGGCAGGTTCCACAAGGCTATCCTCCTGGGCCTTATCAAGGACAGCCTGGCCAAGCTAATTTTGGTGCTTATGGAGGACCAACTGCTATGCCAAATCAGCATGGGGGTCCTGCAGCTGCCTGGATGCCAACACCTGCTCCCATCCCTAACTGCCCACCAGGACTGGAATATCTGAGCCAGATTGACCAGATACTGGTTCACCAACAAGTTGAGCTGCTTGAAGCATTGACTGGATACCAAACAAACAACAAATATGAGATTAAAAACAGCCTGGGCCAAAGAGTCTACTTTGCTGCAGAAGAAAATGATTGCTGCACACGAAACTGCTGTGGGCCAAGCCGACCCTTTACCATGAACATTGTTGATAACACGGGTCGGGAAATTATGAAATTAACCAGCCCTGCAGATGTTCCTCCTGTTTTTTCCCCTGTTGCCCAACAAAACTTAAAATTCAAGCAACCCCCGGGGAACATTTTTTTGTTTAT
Full Trace Sequence: CGAGGGCCCAATAATAGATTTTANTTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGAAATGAAAGATACCAGTGAACCTAAACCCGATCCTGGTTATGGCAACCAAGGTTACCCAGGGGCAGATTATCCAGGTTATCCCCCACCACAAAATCCTTATGGGTACCAACCTGCTGGATATCCACCTGCTGGGTACCAACCTACTGGATATCCACCTGCTGGGTATCAGCCTGCTGGATATCCACCTGCTGGGTACCAACCTGCTGGATATCCACCTGCTGGGTACCAACCTGCTGGATATCCACCTCCTGGTGGGCAGGTTCCACAAGGCTATCCTCCTGGGCCTTATCAAGGACAGCCTGGCCAAGCTAATTTTGGTGCTTATGGAGGACCAACTGCTATGCCAAATCAGCATGGGGGTCCTGCAGCTGCCTGGATGCCAACACCTGCTCCCATCCCTAACTGCCCACCAGGACTGGAATATCTGAGCCAGATTGACCAGATACTGGTTCACCAACAAGTTGAGCTGCTTGAAGCATTGACTGGATACCAAACAAACAACAAATATGAGATTAAAAACAGCCTGGGCCAAAGAGTCTACTTTGCTGCAGAAGAAAATGATTGCTGCACACGAAACTGCTGTGGGCCAAGCCGACCCTTTACCATGAACATTGTTGATAACACGGGTCGGGAAATTATGAAATTAACCAGCCCTGCAGATGTTCCTCCTGTTTTTTCCCCTGTTGCCCAACAAAACTTAAAATTCAAGCAACCCCCGGGGAACATTTTTTTGTTTAT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAAATGAAAGATACCAGTGAA

Sequences - 3ʹ (reverse) EST

Accession: JZ837764
dbEST ID: 79655466
Trimmed Sequence: GTTTTTTTTCTCACTCTCTTCAAAAAACATGAAATCAATGAGAAAACAGGCACCAAGCAGGACAGCTTTGACCTTTACATCAAGGTCCATTGGGAACTGGATTCCAAAGTTGTCAGCGTCAGTGAAAGCTTCTTTTACATAACCAGTCCACTGTTTGGTGATTCTGCCAACCACTGAGCTTTCATCCATGGTTTTTACCTCAAAATTAACATCGGTACAACAGCTACACGGAATGCAGGGGCCCTTGATTTTGAGGACACCTTGTTCATTCTCATCCTGAATGGTGAATTTAGGCAGACAAGGATGCCAGTTCTGTTTAACATAACCAACAACTGTCCCAGGAGGTGCCTGCACTTCAAGTTTTTGTAGGCAACAGGGGAAACAACAAGATGAACATCTGCACGGCCTGTTTAATTTCATAATCTCCCGACCCGTGTTATCAACAATTGTCATGGTAAAGGGTCGGCCTGGCCCACAGCAGTTTCTTGTGCATCAATCATTTTCTTCTGCAGCAAAATAAACTCTTTGGCCCAGGCTGTTTTTAATCTCATATTTGTTGGTTGTTTCGGATCCAGTCAATGCTTCAAGCAGCTGATCTTGTATGTGGAACCAGTATCTGGTCAATCTGGCTCAGATATTCCAATCCTGGTGGGGAGTTTAGAAAGGGAGGAAGATTTTGGAATCACCCAGCTGCAGAACCCCCATCCTAATTAGCATAGCAGTTAATCCTCATAACCAACAAAATAATATAGCAGTGCGGGCCTTGTATAAGGCCAAGAAGATGGAGTTGGTGAAAGGGCCAGCCGGAAATTAGAATTCCGGGCAGTTGGTAGGCGAGCACGTCGAGATGGAGAAAATTGGGAGCCGGCCAGGGGGAATAGCGGGGCGGCTGCGACACCGCAGCGCGGGAGGGGGGTTGCGTTGGTTAGCGGCGGGTGGGAGTGTGGGGGGAGAAAAAGTGGGCGGACGAACAGGAGTAGTGTGGGTGGTGGGGGGGGGGAGGTGTGAGCACCGGGCGGGGCGGCGGGGGGGCTGCGGGGCCTCNCGAGGCGGATTGTTTGATGGGGGTGGGTGTTATCTGGTTTGGGGGTGAATTGGGGGGTGTGGTGTGGGGCGGAGAGGGAGGGGAGAGAGGAAAA
Full Trace Sequence: GGGCCGGGCAACAGCCACTGAAGAAGAGAAAACGAGACACCAAAAGGGGAAGAAAGCGCGGAGGGCAAAAAGGAAAAATATATTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTTTTTTTTCTCACTCTCTTCAAAAAACATGAAATCAATGAGAAAACAGGCACCAAGCAGGACAGCTTTGACCTTTACATCAAGGTCCATTGGGAACTGGATTCCAAAGTTGTCAGCGTCAGTGAAAGCTTCTTTTACATAACCAGTCCACTGTTTGGTGATTCTGCCAACCACTGAGCTTTCATCCATGGTTTTTACCTCAAAATTAACATCGGTACAACAGCTACACGGAATGCAGGGGCCCTTGATTTTGAGGACACCTTGTTCATTCTCATCCTGAATGGTGAATTTAGGCAGACAAGGATGCCAGTTCTGTTTAACATAACCAACAACTGTCCCAGGAGGTGCCTGCACTTCAAGTTTTTGTAGGCAACAGGGGAAACAACAAGATGAACATCTGCACGGCCTGTTTAATTTCATAATCTCCCGACCCGTGTTATCAACAATTGTCATGGTAAAGGGTCGGCCTGGCCCACAGCAGTTTCTTGTGCATCAATCATTTTCTTCTGCAGCAAAATAAACTCTTTGGCCCAGGCTGTTTTTAATCTCATATTTGTTGGTTGTTTCGGATCCAGTCAATGCTTCAAGCAGCTGATCTTGTATGTGGAACCAGTATCTGGTCAATCTGGCTCAGATATTCCAATCCTGGTGGGGAGTTTAGAAAGGGAGGAAGATTTTGGAATCACCCAGCTGCAGAACCCCCATCCTAATTAGCATAGCAGTTAATCCTCATAACCAACAAAATAATATAGCAGTGCGGGCCTTGTATAAGGCCAAGAAGATGGAGTTGGTGAAAGGGCCAGCCGGAAATTAGAATTCCGGGCAGTTGGTAGGCGAGCACGTCGAGATGGAGAAAATTGGGAGCCGGCCAGGGGGAATAGCGGGGCGGCTGCGACACCGCAGCGCGGGAGGGGGGTTGCGTTGGTTAGCGGCGGGTGGGAGTGTGGGGGGAGAAAAAGTGGGCGGACGAACAGGAGTAGTGTGGGTGGTGGGGGGGGGGAGGTGTGAGCACCGGGCGGGGCGGCGGGGGGGCTGCGGGGCCTCNCGAGGCGGATTGTTTGATGGGGGTGGGTGTTATCTGGTTTGGGGGTGAATTGGGGGGTGTGGTGTGGGGCGGAGAGGGAGGGGAGAGAGGAAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTTTTTTTTCTCACTCTCTTCA