ORFeome > pmm1 ORF1 – XORFeome v1.0

pmm1 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: pmm1
Gene ID: 974469
Gene Page ID: 974465
ORF Xenbase ID: 17289669

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC081220
Original XGC clone length: 741

Human orthology & disease relationships

NCBI Entrez ID: 5372
Ensembl gene IDs: ENSG00000100417
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 212065,602579

Library Location

Plate ID: GDExl11004
Well Location: C06

Sequences - 5ʹ (forward) EST

Accession: JZ839687
dbEST ID: 79657389
Trimmed Sequence: ATGGCTCAGTGTGACGTTCTGTGTTTGTTTGATGTGGACGGAACCCTGACAGCAGCCAGGCAGAAAGTCTCAAAAGAAATGGCAGAATTTCTACAAGAGCTGCGAAAAAAGGTAAAAGTCGGGGTTGTTGGAGGCTCCGATTTTGAAAAAATCAAGGAACAGCTTGGAGATGATGTTGTTGAACAATTTGACTATGTATTTGCTGAAAATGGGCTTGTGGCTTATAAAGATGGGAAATTCTTGTGCAAACAGAGTATTCACGCCCACTTGGGAGAGGATTTACTGCAAGATATCATCAACTACTGTCTAAGTTACATTGCAAAGCTCAAGCTGCCAAAGAAAAGAGGCACATTTGTGGAATTCCGGAATGGGATGCTTAATGTTTCGCCTATCGGAAGAAACTGTACCCAAGAGGAACGCATTGAGTTCTATGAACTGGATAAAAAAGAACAGTTCAGAGACAAATTTGTGGCTGAATTGCAAAGGGAATTTGCAGGAAGAGGCCTTACATTTTCAATAGGAGGTCAGATAAGCTTTGACGTGTTTCCTACCGGCTGGGACAAGACTTTCTGCCTGGGAATCCTTGAAAATGAGGGCTTCTCAGAGATCTATTTCTTTGGCGACAAAACAATGCCAGGCGGAAACGACTATAAAATCTACACCGACTCCAGGACCAATCGGCCATTCAGTGAACTCTCCGGAAAAAACAAGGGAAATCTGGAAAAGAACTATTCCTTCCGTTTCCCAACTTCCTGGGTAAAAATTGGGGCTTTAAAAAAAAAGAAATTGATTAACAAATTTTTTTTGCAACCAAAAGGGGGCTCCCT
Full Trace Sequence: CGTGGGCCCAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCTCAGTGTGACGTTCTGTGTTTGTTTGATGTGGACGGAACCCTGACAGCAGCCAGGCAGAAAGTCTCAAAAGAAATGGCAGAATTTCTACAAGAGCTGCGAAAAAAGGTAAAAGTCGGGGTTGTTGGAGGCTCCGATTTTGAAAAAATCAAGGAACAGCTTGGAGATGATGTTGTTGAACAATTTGACTATGTATTTGCTGAAAATGGGCTTGTGGCTTATAAAGATGGGAAATTCTTGTGCAAACAGAGTATTCACGCCCACTTGGGAGAGGATTTACTGCAAGATATCATCAACTACTGTCTAAGTTACATTGCAAAGCTCAAGCTGCCAAAGAAAAGAGGCACATTTGTGGAATTCCGGAATGGGATGCTTAATGTTTCGCCTATCGGAAGAAACTGTACCCAAGAGGAACGCATTGAGTTCTATGAACTGGATAAAAAAGAACAGTTCAGAGACAAATTTGTGGCTGAATTGCAAAGGGAATTTGCAGGAAGAGGCCTTACATTTTCAATAGGAGGTCAGATAAGCTTTGACGTGTTTCCTACCGGCTGGGACAAGACTTTCTGCCTGGGAATCCTTGAAAATGAGGGCTTCTCAGAGATCTATTTCTTTGGCGACAAAACAATGCCAGGCGGAAACGACTATAAAATCTACACCGACTCCAGGACCAATCGGCCATTCAGTGAACTCTCCGGAAAAAACAAGGGAAATCTGGAAAAGAACTATTCCTTCCGTTTCCCAACTTCCTGGGTAAAAATTGGGGCTTTAAAAAAAAAGAAATTGATTAACAAATTTTTTTTGCAACCAAAAGGGGGCTCCCT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCTCAGTGTGACGTT

Sequences - 3ʹ (reverse) EST

Accession: JZ839686
dbEST ID: 79657388
Trimmed Sequence: CTGGAAGAATAGCTCTTTGCAGATTGTCCTTGTTTCTTCCGGAGATGTCACTGAATGGCCGATCGTCCTGGAGTCCGTGTAGATTTCATAGTCGTTTCCGCCTGGCATTGTTTTGTCGCCAAAGAAATAGATCTTTGAGAAGCCCTCATTTTCAAGGATTCCCAGGCAGAAAGTCTTGTCCCAGCCGGTAGGAAACACGTCAAAGCTTATCTGACCTCCTATTGAAAATGTAAGGCCTCTTCCTGCAAATTCCCTTTGCAATTCAGCCACAAATTTGTCTCTGAACTGTTCTTTTTTATCCAGTTCATAGAACTCAATGCGTTCCTCTTGGGTACAGTTTCTTCCGATAGGCGAAACATTAAGCATCCCATTCCGGAATTCCACAAATGTGCCTCTTTTCTTTGGCAGCTTGAGCTTTGCAATGTAACTTAGACAGTAGTTGATGATATCTTGCAGTAAATCCTCTCCCAAGTGGGCGTGAATACTCTGTTTGCACAAGAATTTCCCATCTTTATAAGCCACAAGCCCATTTTCAACAAATACATAGTCAAATTGTTCAACAACATCATCTCCAAGCTGTTCCTTGATTTTTTCAAAATCGGAGCCTCAACAACCCCCACTTTAACCTTTTTTCCCAGCTCTTGTAAAAATTTCTGGCATTTCCTTTGGAAACTTTCTGCTGGCCTGCGGGCCGGGCTTCCGGTCCCGTTCCAACAAAACACAAAAATTCACACTGAAAGCACTGGGTGCCACCGTTTTTTTGTAGAAAAAGTT
Full Trace Sequence: GGTAAAACGGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACTGGAAGAATAGCTCTTTGCAGATTGTCCTTGTTTCTTCCGGAGATGTCACTGAATGGCCGATCGTCCTGGAGTCCGTGTAGATTTCATAGTCGTTTCCGCCTGGCATTGTTTTGTCGCCAAAGAAATAGATCTTTGAGAAGCCCTCATTTTCAAGGATTCCCAGGCAGAAAGTCTTGTCCCAGCCGGTAGGAAACACGTCAAAGCTTATCTGACCTCCTATTGAAAATGTAAGGCCTCTTCCTGCAAATTCCCTTTGCAATTCAGCCACAAATTTGTCTCTGAACTGTTCTTTTTTATCCAGTTCATAGAACTCAATGCGTTCCTCTTGGGTACAGTTTCTTCCGATAGGCGAAACATTAAGCATCCCATTCCGGAATTCCACAAATGTGCCTCTTTTCTTTGGCAGCTTGAGCTTTGCAATGTAACTTAGACAGTAGTTGATGATATCTTGCAGTAAATCCTCTCCCAAGTGGGCGTGAATACTCTGTTTGCACAAGAATTTCCCATCTTTATAAGCCACAAGCCCATTTTCAACAAATACATAGTCAAATTGTTCAACAACATCATCTCCAAGCTGTTCCTTGATTTTTTCAAAATCGGAGCCTCAACAACCCCCACTTTAACCTTTTTTCCCAGCTCTTGTAAAAATTTCTGGCATTTCCTTTGGAAACTTTCTGCTGGCCTGCGGGCCGGGCTTCCGGTCCCGTTCCAACAAAACACAAAAATTCACACTGAAAGCACTGGGTGCCACCGTTTTTTTGTAGAAAAAGTT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACTGGAAGAATAGCTCTTTGCAGAT