ORFeome > pmpcb ORF2 – XORFeome v1.0

pmpcb ORF2 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: pmpcb
Gene ID: 1000007
Gene Page ID: 999998
ORF Xenbase ID: 17289711

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC123109
Original XGC clone length: 1440

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11088
Well Location: D05

Sequences - 5ʹ (forward) EST

Accession: JZ838075
dbEST ID: 79655777
Trimmed Sequence: ATGGCGGCGTCCTTAAGGAGACTGAGTGGATATATCGGCAAGGCTGCGATCAGGGGTTTGGTGAGCAAATCACAGCCCATAGGATTTGGAATAAGCAGAAATAGGTCCACACAAGCATTCACCCAAGCAGTTCTAAATGTACCAGAGACTAAGGTGACCGCTTTGGAAAATGGACTAAGAGTTGCTTCAGAGGATTCTGGACTTTTAACTTGCACGGTTGGGCTCTGGATTGATGCTGGAAGCAGGTATGAGAACCAGATGAATAATGGAACTGCACATTTTCTGGAGCACATGGCATTTAAGGGAACTAAAAACCGTTCCCAACTTGACTTGGAGCTGGAGATTGAAAACATGGGTGCTCATCTTAATGCATACACTTCTCGAGAGCAGACTGTGTACTATGCAAAAGCTTTCTCCAAAGATCTACCAAGAGCAGTGGAGATCCTTGCAGACATTATTCAGAACAGCACCCTAGGTGAGGCTGAGATTGAAAGGGAAAGAAGAGTCATCTTACTGGAGATGCAGGAAGTGGAGACCCATCTACAAAAATTGGTTTTGATTATCTGCATGCGACAACCTATCAAAACACTGCTCTGGGAAGGAGAAAACTTCAACCCGCAAAAAAAACAAAACCATAAATCCAATGAATTTGGTG
Full Trace Sequence: GGTTGCGGTCGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCGGCGTCCTTAAGGAGACTGAGTGGATATATCGGCAAGGCTGCGATCAGGGGTTTGGTGAGCAAATCACAGCCCATAGGATTTGGAATAAGCAGAAATAGGTCCACACAAGCATTCACCCAAGCAGTTCTAAATGTACCAGAGACTAAGGTGACCGCTTTGGAAAATGGACTAAGAGTTGCTTCAGAGGATTCTGGACTTTTAACTTGCACGGTTGGGCTCTGGATTGATGCTGGAAGCAGGTATGAGAACCAGATGAATAATGGAACTGCACATTTTCTGGAGCACATGGCATTTAAGGGAACTAAAAACCGTTCCCAACTTGACTTGGAGCTGGAGATTGAAAACATGGGTGCTCATCTTAATGCATACACTTCTCGAGAGCAGACTGTGTACTATGCAAAAGCTTTCTCCAAAGATCTACCAAGAGCAGTGGAGATCCTTGCAGACATTATTCAGAACAGCACCCTAGGTGAGGCTGAGATTGAAAGGGAAAGAAGAGTCATCTTACTGGAGATGCAGGAAGTGGAGACCCATCTACAAAAATTGGTTTTGATTATCTGCATGCGACAACCTATCAAAACACTGCTCTGGGAAGGAGAAAACTTCAACCCGCAAAAAAAACAAAACCATAAATCCAATGAATTTGGTG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGGCGTCCTTAAGGAG

Sequences - 3ʹ (reverse) EST

Accession: JZ838074
dbEST ID: 79655776
Trimmed Sequence: ATCTCTTAGCCAGTACATTCCGCTTCGTATTCTGTCATAATCAGGAAGTTGTCCAATGGGGCCAACAGCAGCAACTGCAGGGCTCTTGTTATAAATATATTTGGTGCATACTTCACGTATTGTTTCAGCACTGATCAAATCAATTCTTGCTTCGAGTTCAGGCAGTGGAATTCTGCGGTTGTAACACAACATCTGTCTACCAATATCTTCACAGATAGGTGTTGACCCGTCCAGTTGAAGCAACATGTTTGTTTTTAGGAGATTCTTAGCACGGGCAACCTCATTTTCAGTCACATTAGTACAGAGTCTGATCCATTCTCTCTGAACAAAATGCATCATATCCTCCACTGTGTTGGGCTCACACACCATATAGAGCCCCCAGAGTCCAGTGTCTGTGTAACATGTGTTGAATGACTGAAAGCTGTGACAGAGGTTTCCATGACATGTGAGCTGGGCAAGTTTACTTGATAAATTCACACCACCGCCAAATGATCTGTCCCAGTTTCCAATAAGTGTATTGGCAACCATAAGTGGAATTTGTGTCGGGGGTGGGACCAACCCACTGCTTCTACGGCAACTGCAATGTGAGCAAGTGGCATTTTATCATCTCGAACACGGATCTCACTACCCTGTGAGGACCAGGGAAGGAAG
Full Trace Sequence: GGGGAAACAGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAATCTCTTAGCCAGTACATTCCGCTTCGTATTCTGTCATAATCAGGAAGTTGTCCAATGGGGCCAACAGCAGCAACTGCAGGGCTCTTGTTATAAATATATTTGGTGCATACTTCACGTATTGTTTCAGCACTGATCAAATCAATTCTTGCTTCGAGTTCAGGCAGTGGAATTCTGCGGTTGTAACACAACATCTGTCTACCAATATCTTCACAGATAGGTGTTGACCCGTCCAGTTGAAGCAACATGTTTGTTTTTAGGAGATTCTTAGCACGGGCAACCTCATTTTCAGTCACATTAGTACAGAGTCTGATCCATTCTCTCTGAACAAAATGCATCATATCCTCCACTGTGTTGGGCTCACACACCATATAGAGCCCCCAGAGTCCAGTGTCTGTGTAACATGTGTTGAATGACTGAAAGCTGTGACAGAGGTTTCCATGACATGTGAGCTGGGCAAGTTTACTTGATAAATTCACACCACCGCCAAATGATCTGTCCCAGTTTCCAATAAGTGTATTGGCAACCATAAGTGGAATTTGTGTCGGGGGTGGGACCAACCCACTGCTTCTACGGCAACTGCAATGTGAGCAAGTGGCATTTTATCATCTCGAACACGGATCTCACTACCCTGTGAGGACCAGGGAAGGAAG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAATCTCTTAGCCAGTACATTCC