ORFeome > pnp ORF1 – XORFeome v1.0

pnp ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: pnp
Gene ID: 1011603
Gene Page ID: 1011597
ORF Xenbase ID: 17289765

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC054317
Original XGC clone length: 750

Human orthology & disease relationships

NCBI Entrez ID: 4860
Ensembl gene IDs: ENSG00000198805,LRG_91
Directly associated (OMIM) disease MIM numbers: 613179
Indirectly associated (Lage, et al.) disease MIM numbers: 101900,102700,103050,108500,124200,170400,208000,266120,278300,300322,300323,600462,601003,601382,601887,602475,603041,603896,605258,609560,609909

Library Location

Plate ID: GDExl11002
Well Location: E12

Sequences - 5ʹ (forward) EST

Accession: JZ839427
dbEST ID: 79657129
Trimmed Sequence: ATGTCTGAGAAGGAAAGTTGCACATATGAGGAGTATAAACAGACATCAGACTGGCTTCTATCCAAAACAAAACATCGTCCCATTGTGGCCATTGTGTGCGGCTCTGGGCTTGGTGGACTAGGGGAACTTCTTAAAGATCAACAGGCTTTCAATTACTGCGACATACCCAACTTCCCCAAGAGCACAGTTCCTGGCCATGCGGGGCGTCTGATATTTGGAAACCTTAGTGGGAAGCCATGTGTATGCATGCAAGGCCGCTTTCATTTCTATGAAGGCTACCCACTGTGGAAGGTGACATTTCCAGTTCGAGTGTTCCACCTAATGGGAGTTGAGGCCATCATTTTAACTAATGCTGCCGGAGGTCTGAACCAAGAGTTCAGTGTAGGAGACATCATGGTGATAAAGGATCACATCAACATGGTAGGATTTGCAGGACAAAATCCATTGTTTGGCCATAATGAAGACAGGTTTGGTCCTCGTTTCCCCCCTATGTCAGATGCATATAACAAGAACATGAGGAGTCTGTTGCTAGCTGCTGGCAAGGAGCTGGGTTATAATAATATGAGAGAAGGGGTGGTATTGTGGGTCTTGGGGGACCTAACTTTGAAACAATTGCTGAATGCCGATTTCTCAACAAGTTAGGTGCAGATGCTGTAGGTATGAGCACAGTACATTAAAGTGGGTGTTGCCAAACACTGCGGCCTGCGCATCCCGGGGATATCACTAATTACCAACAAAGCTTATGGACTATTGCCCAACTTTTCTTGTTC
Full Trace Sequence: CGCGGGCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTCTGAGAAGGAAAGTTGCACATATGAGGAGTATAAACAGACATCAGACTGGCTTCTATCCAAAACAAAACATCGTCCCATTGTGGCCATTGTGTGCGGCTCTGGGCTTGGTGGACTAGGGGAACTTCTTAAAGATCAACAGGCTTTCAATTACTGCGACATACCCAACTTCCCCAAGAGCACAGTTCCTGGCCATGCGGGGCGTCTGATATTTGGAAACCTTAGTGGGAAGCCATGTGTATGCATGCAAGGCCGCTTTCATTTCTATGAAGGCTACCCACTGTGGAAGGTGACATTTCCAGTTCGAGTGTTCCACCTAATGGGAGTTGAGGCCATCATTTTAACTAATGCTGCCGGAGGTCTGAACCAAGAGTTCAGTGTAGGAGACATCATGGTGATAAAGGATCACATCAACATGGTAGGATTTGCAGGACAAAATCCATTGTTTGGCCATAATGAAGACAGGTTTGGTCCTCGTTTCCCCCCTATGTCAGATGCATATAACAAGAACATGAGGAGTCTGTTGCTAGCTGCTGGCAAGGAGCTGGGTTATAATAATATGAGAGAAGGGGTGGTATTGTGGGTCTTGGGGGACCTAACTTTGAAACAATTGCTGAATGCCGATTTCTCAACAAGTTAGGTGCAGATGCTGTAGGTATGAGCACAGTACATTAAAGTGGGTGTTGCCAAACACTGCGGCCTGCGCATCCCGGGGATATCACTAATTACCAACAAAGCTTATGGACTATTGCCCAACTTTTCTTGTTC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCTGAGAAGGAAAGTTGC

Sequences - 3ʹ (reverse) EST

Accession: JZ839426
dbEST ID: 79657128
Trimmed Sequence: TAGTCCATAAGCTTTGTTGGTAATTAGTGATATTCCCAGGATGCGCAGGCCGCAGTGTCTGGCAACAACCACCTCATGTACTGTGCTCATACCTACAGCATCTGCACCTAACTTGTTGAGAAATCGGCATTCAGCAATTGTTTCAAAGTTAGGTCCCCCAAGACCACAATACACCCCTTCTCTCATATTATTATAACCCAGCTCCTTGCCAGCAGCTAGCAACAGACTCCTCATGTTCTTGTTATATGCATCTGACATAGGGGGGAAACGAGGACCAAACCTGTCTTCATTATGGCCAAACAATGGATTTTGTCCTGCAAATCCTACCATGTTGATGTGATCCTTTATCACCATGATGTCTCCTACACTGAACTCTTGGTTCAGACCTCCNGCAGCATTAGTTAAAATGATGGCCTCAACTCCCATTAGGTGGAACACTCGAACTGGAAATGTCACCTTCCACAGTGGGTAGCCTTCATAGAAATGAAAGCGGCCTTGCATGCATACACATGGCTTCCCACTAAGGTTTCCAAATATCAAACGCCCCGCATGGCCAGGAACTGTGCTCTTGGGGAAGTTGGGTATGTCGCAATAATTGAAAGCCTGTTGATCTTTAAGAAATTCCCCTAGTCCCCCCAACCCAGAGCCCCAAACAATGGCCACAATGGGAACAATGTTTTTGTTTTGAAAAAAAACCCAGTCTGAATTCCTGGTTATAACCCCTCATAAGTGTGCAACTTTTCCTTTCAAAAAACGTGGTTGCCAACCCTT
Full Trace Sequence: GGGAAACAGGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATAGTCCATAAGCTTTGTTGGTAATTAGTGATATTCCCAGGATGCGCAGGCCGCAGTGTCTGGCAACAACCACCTCATGTACTGTGCTCATACCTACAGCATCTGCACCTAACTTGTTGAGAAATCGGCATTCAGCAATTGTTTCAAAGTTAGGTCCCCCAAGACCACAATACACCCCTTCTCTCATATTATTATAACCCAGCTCCTTGCCAGCAGCTAGCAACAGACTCCTCATGTTCTTGTTATATGCATCTGACATAGGGGGGAAACGAGGACCAAACCTGTCTTCATTATGGCCAAACAATGGATTTTGTCCTGCAAATCCTACCATGTTGATGTGATCCTTTATCACCATGATGTCTCCTACACTGAACTCTTGGTTCAGACCTCCNGCAGCATTAGTTAAAATGATGGCCTCAACTCCCATTAGGTGGAACACTCGAACTGGAAATGTCACCTTCCACAGTGGGTAGCCTTCATAGAAATGAAAGCGGCCTTGCATGCATACACATGGCTTCCCACTAAGGTTTCCAAATATCAAACGCCCCGCATGGCCAGGAACTGTGCTCTTGGGGAAGTTGGGTATGTCGCAATAATTGAAAGCCTGTTGATCTTTAAGAAATTCCCCTAGTCCCCCCAACCCAGAGCCCCAAACAATGGCCACAATGGGAACAATGTTTTTGTTTTGAAAAAAAACCCAGTCTGAATTCCTGGTTATAACCCCTCATAAGTGTGCAACTTTTCCTTTCAAAAAACGTGGTTGCCAACCCTT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATAGTCCATAAGCTTTGTTGGTAAT