ORFeome > pofut1 ORF1 – XORFeome v1.0

pofut1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: pofut1
Gene ID: 979250
Gene Page ID: 979242
ORF Xenbase ID: 17289825

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC106426
Original XGC clone length: 1143

Human orthology & disease relationships

NCBI Entrez ID: 23509
Ensembl gene IDs: ENSG00000101346
Directly associated (OMIM) disease MIM numbers: 615327
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11086
Well Location: D12

Sequences - 5ʹ (forward) EST

Accession: JZ837965
dbEST ID: 79655667
Trimmed Sequence: ATGGAGCGCGGTGTTTGGCTTTTTCTTCTGCTTCTGCCCTTTGTCGGGTGTGAGGGGCTTTATAACTCTAACGGATACATCGTGTACTGCCCCTGCATGGGGCGATTTGGCAATCAAGCGGATCATTTCTTGGGATCCTTAGCATTTGCTAAGATGGTAAATCGTACCCTCGTGGTTCCGCCATGGATTGTTTATAATCACCATAGGCCACCGTACACCAATGTGCATGTCCCGTATGAGGAATTCTTTCAGCTGGAGCCCCTGCGCCAGTTTCATCAAGTGATCAGCATGGAGGAATTTATGGAACAATTAGCGCCAGTGTTGTGGCCCCCCACTAAGCGATTGGCCTATTGTTTCACAGCCGCAGCCCACAGGAGCCCTGATAAGAAGAGCTGCCCTATGAAGGATGGAAACCCATTTGGGCCTTTCTGGGATCACTTTCATGTGGATTTCACTCAGTCTGAGCTATTTGATGGCATTACCTTCAGTGCCTATTATAAAGATGTGTGGATTAGCAGGTTTCCCCCATCCCAGCACCCAGTCATCGCTCTCCCAGGGGCCCCGGCACAGTTCCCAGTTTTAAAGGAGCATCGATCACTGGCGAAATACATAATGTGGTCTGAGAAAATTGGGCCTGAAGGAAAGGAACGAACCGATCAATGCTTGTAAAGCCGTAAGTGGGAATTCATCTTAGGATTGGCTCTAATTGGAAAATGCTTTAAAAATCTGAAAAGAAGAAAACGGCGCGGTTCCGATTTCTTGGCCCTCCCCCATTGTGTTTGCCTAATAACAAAGTCAAGTTATCTCCCCCCC
Full Trace Sequence: CGAGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGAGCGCGGTGTTTGGCTTTTTCTTCTGCTTCTGCCCTTTGTCGGGTGTGAGGGGCTTTATAACTCTAACGGATACATCGTGTACTGCCCCTGCATGGGGCGATTTGGCAATCAAGCGGATCATTTCTTGGGATCCTTAGCATTTGCTAAGATGGTAAATCGTACCCTCGTGGTTCCGCCATGGATTGTTTATAATCACCATAGGCCACCGTACACCAATGTGCATGTCCCGTATGAGGAATTCTTTCAGCTGGAGCCCCTGCGCCAGTTTCATCAAGTGATCAGCATGGAGGAATTTATGGAACAATTAGCGCCAGTGTTGTGGCCCCCCACTAAGCGATTGGCCTATTGTTTCACAGCCGCAGCCCACAGGAGCCCTGATAAGAAGAGCTGCCCTATGAAGGATGGAAACCCATTTGGGCCTTTCTGGGATCACTTTCATGTGGATTTCACTCAGTCTGAGCTATTTGATGGCATTACCTTCAGTGCCTATTATAAAGATGTGTGGATTAGCAGGTTTCCCCCATCCCAGCACCCAGTCATCGCTCTCCCAGGGGCCCCGGCACAGTTCCCAGTTTTAAAGGAGCATCGATCACTGGCGAAATACATAATGTGGTCTGAGAAAATTGGGCCTGAAGGAAAGGAACGAACCGATCAATGCTTGTAAAGCCGTAAGTGGGAATTCATCTTAGGATTGGCTCTAATTGGAAAATGCTTTAAAAATCTGAAAAGAAGAAAACGGCGCGGTTCCGATTTCTTGGCCCTCCCCCATTGTGTTTGCCTAATAACAAAGTCAAGTTATCTCCCCCCC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAGCGCGGTGTTTGGCTT

Sequences - 3ʹ (reverse) EST

Accession: JZ837964
dbEST ID: 79655666
Trimmed Sequence: CAGCTCATCCTGCACCACCCCAGGGGAATCCATGCCAAAGAATGATGATGGTCTTCCATGAACATCTCGATCTCGCTTGACAAAAGCAGTGAAAGAGGAAACACAGTTACCAATAAAATGGTCGGCCTGGGCCAGGATGTATAGATCAATCTGAGCCACCTCTGGCTGGAGACACACAACTCTCACCTCGTTTCCCAAGAAAGCTTGTATCTCTGCAGTGTATGAGGTGGAGTCAGTGGCAATATACACTGATCTGGCATTAGACCTTTCCACCCATAGCGTCAACGCTCGTCTCATCTCCTTGAGATCAGGAAGGCACATGTCCATGGTGAGGGGGGCAGCACTGTACCTGTCATAGCCAACACACTGTGGGGAGGCCATGAAATGGGAACCGGCCGTTCCATCCTTCAGCATTTTACAAGCATTTTTCCAATCAGAGCCAATCCTCAGATGAATTCCCACATACGGCCTTACAAGCAGTGATCGGATCTGTTCCTCTCCCTCACGCACAATCTTCTCAGACCACACTATGTATCTCTGCANTGATCGATGCTCCTCTAAAACTGCGAACTGTGCCGGGGCCCCTGGGAGAGCGATGACTGGGTGCTGGGAATGGGGGAAACCTGCCAATCCCACACACCTTATAAAAGGCCCTGAAAAGTAATGGCCATCAAAAAGCTCAAACCGAATTGAAATCCCACCTAAAAATTAGTCCCCAAAAAAGGCCCCAAAATGGGTTTTTCCACCCCCTTCCTAAGGGGGCAACCTCCTTC
Full Trace Sequence: GAAAAGGGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACAGCTCATCCTGCACCACCCCAGGGGAATCCATGCCAAAGAATGATGATGGTCTTCCATGAACATCTCGATCTCGCTTGACAAAAGCAGTGAAAGAGGAAACACAGTTACCAATAAAATGGTCGGCCTGGGCCAGGATGTATAGATCAATCTGAGCCACCTCTGGCTGGAGACACACAACTCTCACCTCGTTTCCCAAGAAAGCTTGTATCTCTGCAGTGTATGAGGTGGAGTCAGTGGCAATATACACTGATCTGGCATTAGACCTTTCCACCCATAGCGTCAACGCTCGTCTCATCTCCTTGAGATCAGGAAGGCACATGTCCATGGTGAGGGGGGCAGCACTGTACCTGTCATAGCCAACACACTGTGGGGAGGCCATGAAATGGGAACCGGCCGTTCCATCCTTCAGCATTTTACAAGCATTTTTCCAATCAGAGCCAATCCTCAGATGAATTCCCACATACGGCCTTACAAGCAGTGATCGGATCTGTTCCTCTCCCTCACGCACAATCTTCTCAGACCACACTATGTATCTCTGCANTGATCGATGCTCCTCTAAAACTGCGAACTGTGCCGGGGCCCCTGGGAGAGCGATGACTGGGTGCTGGGAATGGGGGAAACCTGCCAATCCCACACACCTTATAAAAGGCCCTGAAAAGTAATGGCCATCAAAAAGCTCAAACCGAATTGAAATCCCACCTAAAAATTAGTCCCCAAAAAAGGCCCCAAAATGGGTTTTTCCACCCCCTTCCTAAGGGGGCAACCTCCTTC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACAGCTCATCCTGCACCAC