ORFeome > pole2 ORF1 – XORFeome v1.0

pole2 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: pole2
Gene ID: 973819
Gene Page ID: 973811
ORF Xenbase ID: 17289873

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC097773
Original XGC clone length: 1584

Human orthology & disease relationships

NCBI Entrez ID: 5427
Ensembl gene IDs: ENSG00000100479
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 194050,214150,216400,223100,259500,277700,278300,278780,307030,601675,603903

Library Location

Plate ID: GDExl11089
Well Location: F11

Sequences - 5ʹ (forward) EST

Accession: JZ838360
dbEST ID: 79656062
Trimmed Sequence: ATGGCTACTGACAAGCTGAAGAGCAAAGTATCCTCTGCGTTTAAAATGCATGGCTTGATGTTACGAGCAGAGGCCAGTAAATATCTAAGTGAAGTTTTAAGTTCTGTAAATGAAGTGGAGCTTGAAGATGTGATTGATAGCATCATAGATGCTGTAGAAAAACAGCCCTTGTCCTCTAATATGATTGAGAAATCAACAGTGGAAGCAGCTGTTCAGGAATGCAGCCGGACTTGTGATGAAACCATTGAGCATATTTTCAATATTATTGGTGCTTTTGACATACCTCGATACGTCTACAACTCAGAAAGAAAGAAATTCCTTCCCCTGAAAATGACTACTCTCCCATCACCCAATCTCTTTGGAAGGGCAAGAGACAAAGCTGAGCTTTTTCGTGAGCGTTACACAATCTTGCAGCAGAGAACTCACAGACATGAACTGTTTACTCCTCCTGTCATTGGTTCACATCCTGATGAAAGCAGGAGCAAATTTCAGCTTAAAACAGTGGAAACCCTTCTAGGAAACACTGCTAAAGTGGGTGAAGTGATTGTCCTGGGAATGATAACCCAGATGAAAGAGGGAAAATATTTCTTGGAGGATCCAACTGGAGCAGTACAGCTTGATCTCACCAATGCACAGTTTCACAGTGGTCTGTACACAGAGTCATGCT
Full Trace Sequence: TCGAGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCTACTGACAAGCTGAAGAGCAAAGTATCCTCTGCGTTTAAAATGCATGGCTTGATGTTACGAGCAGAGGCCAGTAAATATCTAAGTGAAGTTTTAAGTTCTGTAAATGAAGTGGAGCTTGAAGATGTGATTGATAGCATCATAGATGCTGTAGAAAAACAGCCCTTGTCCTCTAATATGATTGAGAAATCAACAGTGGAAGCAGCTGTTCAGGAATGCAGCCGGACTTGTGATGAAACCATTGAGCATATTTTCAATATTATTGGTGCTTTTGACATACCTCGATACGTCTACAACTCAGAAAGAAAGAAATTCCTTCCCCTGAAAATGACTACTCTCCCATCACCCAATCTCTTTGGAAGGGCAAGAGACAAAGCTGAGCTTTTTCGTGAGCGTTACACAATCTTGCAGCAGAGAACTCACAGACATGAACTGTTTACTCCTCCTGTCATTGGTTCACATCCTGATGAAAGCAGGAGCAAATTTCAGCTTAAAACAGTGGAAACCCTTCTAGGAAACACTGCTAAAGTGGGTGAAGTGATTGTCCTGGGAATGATAACCCAGATGAAAGAGGGAAAATATTTCTTGGAGGATCCAACTGGAGCAGTACAGCTTGATCTCACCAATGCACAGTTTCACAGTGGTCTGTACACAGAGTCATGCT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCTACTGACAAGCTGA

Sequences - 3ʹ (reverse) EST

Accession: JZ838359
dbEST ID: 79656061
Trimmed Sequence: AAGATTCTGAAGTTTGCTGTCTTCAGCTGTTTTGCTGGAGGGATAGTAGACCTTGAAGGAAAACCCACTTCTTGGAAATGATCCAGGGTTGATGGTCAGACATTCTGTGTTGGTGATGGTGAATGGATCATATTTATCAGCGATGACAACCAAGTCTGGTAGCGGATACAACCTCAGAGCATAATCATATGCCCAGTATACAGGGCTAACAAATGGAGGGAGAGGAGTCAAATGTCCTTGGGATAAGATGGTTTTGACAAAATGGCTAGGAATATCCAAACTGCTGTTGGGAAAACGAACACAATTTCTGCACATTTTATTTACCAAATCTTCACGGAAAACAACAATTTCCTGTGTACAGTACTGGATCCTGCAGGGATTTGTAGTAAAAATGGAGAATGGTACTCGTTGGCGGAATTCTTCAGTGATATGATCAGCAATTGGAGGTCTTGGTAAAATGAAACCAGGGCCTGGGTCTTCAGGGCCAGGTACAAAAACAAATCGACTGCTTTTATGTATATTTGGATATTCACATATTATATCTGCCAGTATTTTAAATGAATCTTTTAATGATTGGATATGATTTTTTCCGTAAAGGTGCAGAGAAAAAGTTTCCACAGATTATAAAACAAGGTTGGTGGTGCTGTTGGAG
Full Trace Sequence: GGGAAAATGCTATGGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAAGATTCTGAAGTTTGCTGTCTTCAGCTGTTTTGCTGGAGGGATAGTAGACCTTGAAGGAAAACCCACTTCTTGGAAATGATCCAGGGTTGATGGTCAGACATTCTGTGTTGGTGATGGTGAATGGATCATATTTATCAGCGATGACAACCAAGTCTGGTAGCGGATACAACCTCAGAGCATAATCATATGCCCAGTATACAGGGCTAACAAATGGAGGGAGAGGAGTCAAATGTCCTTGGGATAAGATGGTTTTGACAAAATGGCTAGGAATATCCAAACTGCTGTTGGGAAAACGAACACAATTTCTGCACATTTTATTTACCAAATCTTCACGGAAAACAACAATTTCCTGTGTACAGTACTGGATCCTGCAGGGATTTGTAGTAAAAATGGAGAATGGTACTCGTTGGCGGAATTCTTCAGTGATATGATCAGCAATTGGAGGTCTTGGTAAAATGAAACCAGGGCCTGGGTCTTCAGGGCCAGGTACAAAAACAAATCGACTGCTTTTATGTATATTTGGATATTCACATATTATATCTGCCAGTATTTTAAATGAATCTTTTAATGATTGGATATGATTTTTTCCGTAAAGGTGCAGAGAAAAAGTTTCCACAGATTATAAAACAAGGTTGGTGGTGCTGTTGGAG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAAGATTCTGAAGTTTGCTGTCTTC