ORFeome > pole3 ORF1 – XORFeome v1.0

pole3 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: pole3
Gene ID: 6251911
Gene Page ID: 6457394
ORF Xenbase ID: 17289879

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC129051
Original XGC clone length: 444

Human orthology & disease relationships

NCBI Entrez ID: 54107
Ensembl gene IDs: ENSG00000148229
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 223100,307030,603903

Library Location

Plate ID: GDExl11087
Well Location: D09

Sequences - 5ʹ (forward) EST

Accession: JZ838093
dbEST ID: 79655795
Trimmed Sequence: ATGGCCGAGAGACCCGAAGATCTCAACTTGCCCAACGCCGTGGTCACGCGGATCATTAAGGAGGCTCTCCCAGAAGGGGTTAATATCTCCAAAGAAGCGCGCAGTGCAATATCCCGGGCGGCCAGTGTCTTTGTACTGTATGCGACATCTTGTGCCAATAACTTCGCCATGAAGGGGAAGCGCAAGACTCTCAATGCGAGTGATGTTTTGGCTGCGATGGAAGAGATGGAATTCCAGCGATTTCTTACACCTCTGAAAGAATCCTTGGAAGTTTACAGGCAGGATCAGAAAGGTAAGAAAGAGGCCACAGAGCAGAAGAAGAAAGACAAGGAGAAAAAGGCCGACTCTGAGGATCAGGACAAGAGCCGGGAAGAGGAGAACGAGGAGGAAGATGAGAAGATGGAAGAAGATGAAGTAGTGGAAGAGGAGGAAGTTGAGAACTT
Full Trace Sequence: TCGGGGCCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCCGAGAGACCCGAAGATCTCAACTTGCCCAACGCCGTGGTCACGCGGATCATTAAGGAGGCTCTCCCAGAAGGGGTTAATATCTCCAAAGAAGCGCGCAGTGCAATATCCCGGGCGGCCAGTGTCTTTGTACTGTATGCGACATCTTGTGCCAATAACTTCGCCATGAAGGGGAAGCGCAAGACTCTCAATGCGAGTGATGTTTTGGCTGCGATGGAAGAGATGGAATTCCAGCGATTTCTTACACCTCTGAAAGAATCCTTGGAAGTTTACAGGCAGGATCAGAAAGGTAAGAAAGAGGCCACAGAGCAGAAGAAGAAAGACAAGGAGAAAAAGGCCGACTCTGAGGATCAGGACAAGAGCCGGGAAGAGGAGAACGAGGAGGAAGATGAGAAGATGGAAGAAGATGAAGTAGTGGAAGAGGAGGAAGTTGAGAACTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCGGGCAGCTCAAAAAAAAAAAAAAAAAAAAAAAAAAATTACACAAGCCCCATTAAGAACCGGGGGAAAAAAAACCAACACCCCCCCCCCAAGAGGGGGGGGGTTTTCAAATAAAAAAAAAAAAAGAAAAAAAACATAAAAAAAAAACCACCTCTCGGGGTCTATTAAAATATAGAAAAGAAAGAGGAGGC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCCGAGAGACCCGA

Sequences - 3ʹ (reverse) EST

Accession: JZ838092
dbEST ID: 79655794
Trimmed Sequence: GTTCTCAACTTCCTCCTCTTCCACTACTTCATCTTCTTCCATCTTCTCATCTTCCTCCTCGTTCTCCTCTTCCCGGCTCTTGTCCTGATCCTCAGAGTCGGCCTTTTTCTCCTTGTCTTTCTTCTTCTGCTCTGTGGCCTCTTTCTTACCTTTCTGATCCTGCCTGTAAACTTCCAAGGATTCTTTCAAAGGTGTAAGAAATCGCTGGAATTCCATCTCTTCCATCGCAGCCAAAACATCACTCGCATTGAGAGTCTTGCGCTTCCCCTTCATGGCGAAGTTATTGGCACAAGATGTCGCATACAGTACAAAGACACTGGCCGCCCGGGATATTGCACTGCGCGCTTCTTTGGAGATATTAACCCCTTCTGGGAGAGCCTCCTTAATGATCCGCGTGACCACGGCGTTGGGCAAGTTGAGATCTTCGGGTCTCTCGGCCATGG
Full Trace Sequence: GGGGAATAGGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCNTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTTCTCAACTTCCTCCTCTTCCACTACTTCATCTTCTTCCATCTTCTCATCTTCCTCCTCGTTCTCCTCTTCCCGGCTCTTGTCCTGATCCTCAGAGTCGGCCTTTTTCTCCTTGTCTTTCTTCTTCTGCTCTGTGGCCTCTTTCTTACCTTTCTGATCCTGCCTGTAAACTTCCAAGGATTCTTTCAAAGGTGTAAGAAATCGCTGGAATTCCATCTCTTCCATCGCAGCCAAAACATCACTCGCATTGAGAGTCTTGCGCTTCCCCTTCATGGCGAAGTTATTGGCACAAGATGTCGCATACAGTACAAAGACACTGGCCGCCCGGGATATTGCACTGCGCGCTTCTTTGGAGATATTAACCCCTTCTGGGAGAGCCTCCTTAATGATCCGCGTGACCACGGCGTTGGGCAAGTTGAGATCTTCGGGTCTCTCGGCCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGGGGGCCCGACCTTAAAACAAAAAAACAAAATCACACACTTAAAACTGGGATCAATAAAAACCGCGCCGGGAAAAAAAACAAAAAACTTTCGTTAACCCAAAAGGGCGGGTCTGTAAACTTAATAAAAAAAAATAAAGAACACCCCCCCAATAAAAAAAAAAAAACCGTTGGCGCCGGGTGGTGCTTTATTTTAAGAATAAAAGCGGCGGCGCGGCGCGGCGTGCGGGAAAAAAAAAAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTTCTCAACTTCCTCCTCT