ORFeome > polr2b ORF1 – XORFeome v1.0

polr2b ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: polr2b
Gene ID: 1012879
Gene Page ID: 1012873
ORF Xenbase ID: 17289903

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC060458
Original XGC clone length: 2850

Human orthology & disease relationships

NCBI Entrez ID: 5431
Ensembl gene IDs: ENSG00000047315
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 148700,151623,154500,162210,164300,193520,204000,214150,214450,216400,253300,253400,253550,256710,268000,277700,278300,278780,300590,303600,600334,601675,601777,602875,603689,604145,607136,608807,608808,609065,609227

Library Location

Plate ID: GDExl11022
Well Location: B02

Sequences - 5ʹ (forward) EST

Accession: JZ824798
dbEST ID: 79642500
Trimmed Sequence: ATGTACGATGCAGATGAAGATATGCAATATGATGAAGATGATGATGAAATCACTCCAGATCTGTGGCAGGAGGCATGTTGGATTGTTATTAGCTCTTATTTTGATGAAAAAGGTTTAGTACGGCAACAGCTTGATTCCTTTGATGAGTTTATACAGATGTCCGTACAGAGGATTGTCGAAGATGCCCCACCTATAGACCTTCAAGCTGAAGCTCAACATACGACAGGAGAAGTAGAAGAGCCTCCTAGGTACCTGTTAAAATTTGAACAGATTTATTTATCTAAGCCTACACATTGGGAAAGAGATGGTGCACCCTCACCAATGATGCCAAATGAAGCAAGGTTAAGAAATCTAACATATTCTGCCCCTCTTTATGTGGACATAACTAAGACCGTGGTTAAAGAAGGAGAGGAACAAATTCAAACACAACATCAGAAAACATTTATTGGCAAAATACCAATTATGTTACGATCAACATACTGTTTGTTGAATGGACTGACTGACCGTGATCTTTGTGAGTTAAATGAATGCCCACTTGATCCAGGCGGCTACTTTATTATAAATGGATCTGAAAAGGTTCTTATTGCTCAAGAAAAGATGGCTACAAACACAGTATATGTGTTTGCAAAGAAAGATTCAAAGTATGCTTACACTGCTGAGTGTAGGTCCTGTCTGGAAAATTCGTCAAGACCAACTAGTTCTATATGGGTTAGCATGCTTTGCAGAGGAGGTCAGGGTGCCNAAAAAAGTGCCATAGGNNTCACGCATTGTTTGCAACCCTTACTTTATATTCAGGCAAGGAAGTTTCCAAATTAATTATTTGGTCTTTC
Full Trace Sequence: AATGATTTTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTACGATGCAGATGAAGATATGCAATATGATGAAGATGATGATGAAATCACTCCAGATCTGTGGCAGGAGGCATGTTGGATTGTTATTAGCTCTTATTTTGATGAAAAAGGTTTAGTACGGCAACAGCTTGATTCCTTTGATGAGTTTATACAGATGTCCGTACAGAGGATTGTCGAAGATGCCCCACCTATAGACCTTCAAGCTGAAGCTCAACATACGACAGGAGAAGTAGAAGAGCCTCCTAGGTACCTGTTAAAATTTGAACAGATTTATTTATCTAAGCCTACACATTGGGAAAGAGATGGTGCACCCTCACCAATGATGCCAAATGAAGCAAGGTTAAGAAATCTAACATATTCTGCCCCTCTTTATGTGGACATAACTAAGACCGTGGTTAAAGAAGGAGAGGAACAAATTCAAACACAACATCAGAAAACATTTATTGGCAAAATACCAATTATGTTACGATCAACATACTGTTTGTTGAATGGACTGACTGACCGTGATCTTTGTGAGTTAAATGAATGCCCACTTGATCCAGGCGGCTACTTTATTATAAATGGATCTGAAAAGGTTCTTATTGCTCAAGAAAAGATGGCTACAAACACAGTATATGTGTTTGCAAAGAAAGATTCAAAGTATGCTTACACTGCTGAGTGTAGGTCCTGTCTGGAAAATTCGTCAAGACCAACTAGTTCTATATGGGTTAGCATGCTTTGCAGAGGAGGTCAGGGTGCCNAAAAAAGTGCCATAGGNNTCACGCATTGTTTGCAACCCTTACTTTATATTCAGGCAAGGAAGTTTCCAAATTAATTATTTGGTCTTTC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTACGATGCAGATGAAGATATG

Sequences - 3ʹ (reverse) EST

Accession: JZ830167
dbEST ID: 79647869
Trimmed Sequence: TAGGTGCCTCTGGATCATGCTGACACTGCATTCATTCAGATTTGAATATTTTCCAAAATATACAATACTTGTAAAACTTACCCTTATTTTACAAAACTTGTACCCCTCTTGATTAAGTGTCACCATAACCTGATCAACAATTCCAGTTTCACTGGTACGCAGAAAAGTACTACAGTCTCTCTTGGTGTAACGGCGGTTAGTACTTTCTAACTCATCTTCATTTTCAGGCAGAGTTACTGTCTTGCCAATGATTACATCATCCCCCGACACACGTACACCAGGTGCTATCAAGCCATCATCATCAAGTTTATCATAGATAGCATGCCTCATTCCCTGGCACGTTTCACGAGTTGGTTTCTCAAAAACCTCTTCTTGATCAAATCCCTTTTTGGACTCTTGTTCTTTGTACGAACGGTAGAAAACAGACCTGAAAAATCCTCTGTCAACAGCAGAGCGATTCATAATAACAGAGTCTTCTTGATTATATCCAGTATAAGAAGCAATAGCTACAATGGAGTTGATACCTGCTGGAAGTTCTCTGAATCTCANGTACTCCATGGACCTTGTAGTTACCAGAGGTTTCTGGGGGTAATATAAAACGTGTGCCAAGGTATCCATACGAACATGAAAATTTGTAATATAGACACCCATTGCCTGCTTACCCATGGCAAAATTGATATGTGTTTTCTAGGAGACTTGGTTATGAATCAGGGGATTGTAAATAAATAGAAAGCCACAAACTTCCCAAGGAATCCTT
Full Trace Sequence: ACGCACGGGAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATAGGTGCCTCTGGATCATGCTGACACTGCATTCATTCAGATTTGAATATTTTCCAAAATATACAATACTTGTAAAACTTACCCTTATTTTACAAAACTTGTACCCCTCTTGATTAAGTGTCACCATAACCTGATCAACAATTCCAGTTTCACTGGTACGCAGAAAAGTACTACAGTCTCTCTTGGTGTAACGGCGGTTAGTACTTTCTAACTCATCTTCATTTTCAGGCAGAGTTACTGTCTTGCCAATGATTACATCATCCCCCGACACACGTACACCAGGTGCTATCAAGCCATCATCATCAAGTTTATCATAGATAGCATGCCTCATTCCCTGGCACGTTTCACGAGTTGGTTTCTCAAAAACCTCTTCTTGATCAAATCCCTTTTTGGACTCTTGTTCTTTGTACGAACGGTAGAAAACAGACCTGAAAAATCCTCTGTCAACAGCAGAGCGATTCATAATAACAGAGTCTTCTTGATTATATCCAGTATAAGAAGCAATAGCTACAATGGAGTTGATACCTGCTGGAAGTTCTCTGAATCTCANGTACTCCATGGACCTTGTAGTTACCAGAGGTTTCTGGGGGTAATATAAAACGTGTGCCAAGGTATCCATACGAACATGAAAATTTGTAATATAGACACCCATTGCCTGCTTACCCATGGCAAAATTGATATGTGTTTTCTAGGAGACTTGGTTATGAATCAGGGGATTGTAAATAAATAGAAAGCCACAAACTTCCCAAGGAATCCTT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATAGGTGCCTCTGGATCAT